Dataset for CDS LMW5-HL of organism all

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A0C5AZD3_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagctcatatatcataatatcattaatgaaatactcgtgggatatattaaatattacatgaatgatat
ttcagagcatgaacttagcccgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttgaacaagcagg
ttacaattaccttttctcttacgagtgcccaagaaattaaaacccagtttactgaggttgtgactgagttgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtactgcaaagatgccaacaacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatttattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttaagatcctgtgtacatttattaagaaactgcaatttgatctag
>gnl|bcl2dbcds|A0A7R8V9Y5_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagctcatatatcataatatcattaatgaaatactcgtgggatatattaaatattacatgaatgatat
ttcagagcatgaacttagcccgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttgaacaagcagg
ttacaattaccttttctcttacgagtgcccaagaaattaaaacccagtttactgaggttgtgactgagttgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtactgcaaagatgccaacaacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatttattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttaaaatcctgtgtacatttattaagaaactgcaatttgatctag
>gnl|bcl2dbcds|A9JKY0_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagttaatatatcataatatcattaatgaaatactagtgggttatattaaatattacattaatgatat
ttcagagcatgagcttagcccatatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttgaacaaacagg
ttataattaccttttctcttacgagtgtccaagaaattaaaacccagtttactggggttgtgactgagctgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtattgcaaagacgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatgtattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttcagatcctgtgtacagttattaagaaactgcaatttgatatag
>gnl|bcl2dbcds|A9JLP1_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagttaatatatcataatatcattaatgaaatactagtgggttatattaaatattacattaatgatat
ttcagagcatgagcttagcccatatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttgaacaaacagg
ttacaattaccttttctcttacgagtgtccaagaaattaaaacccagtttactggggttgtgactgagctgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtattgcaaagacgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatgtattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttcagatcctgtgtacagttattaagaaactgcaatttgatatag
>gnl|bcl2dbcds|D0Q0E8_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagttaatatatcataatatcattaatgaaatactagtgggttatattaaatattacattaatgatat
ttcagagcatgagcttagcccatatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttgaacaaacagg
ttacaattaccttttctcttacgagtgtccaagaaattaaaacccagtttactggggttgtgactgagctgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtattgcaaagacgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatgtattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttcagatcctgtgtacagttattaagaaactgcaatttgatatag
>gnl|bcl2dbcds|D4I5M9_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagttaatatatcataatatcattaatgaaatactagtgggttatattaaatattacattaatgatat
ttcagagcatgagcttagcccatatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttgaacaaacagg
ttacaattaccttttctcttacgagtgtccaagaaattaaaacccagtttactggggttgtgactgagctgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtattgcaaagacgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatgtattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttcagatcctgtgtacagttattaagaaactgcaatttgatatag
>gnl|bcl2dbcds|P42485_LMW5HL-01 LMW5-HL gene OS=[Viruses] African swine fever virus GN=LMW5-HL (length=540 residues).
atggagggagaagagttaatatatcataatatcattaatgaaatactagtgggttatattaaatattacattaatgatat
ttcagagcatgagcttagcccatatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttgaacaaacagg
ttacaattaccttttctcttacgagtgtccaagaaattaaaacccagtttactggggttgtgactgagctgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtattgcaaagacgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatgtattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttcagatcctgtgtacagttattaagaaactgcaatttgatatag
© 1998-2022Legal notice