Dataset for CDS E1B19K of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

417 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      atgattaactgctgtgaactttggttgtttattcaaagggtattacctgg
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        atgattaacggctgtgaactttggttgtttattcaaaggggattacctgg
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
F2WTM9_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
A0A1C8EG46_E1B19K-      atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAN8_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAS0_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAV3_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
H9AAY5_E1B19K-01        atgattaac-gatgtgaactttgtctgtttattcaaaggggattacctgg
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      ---------------------------atgactcatgggcggggcttagt
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        ---------------------------atgactcatgggcgtggcttagt
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      ---------------------------atgactcatgggcggggcttagt
C5HDR2_E1B19K-01        ---------------------------atgactcatgggcggggcttagt
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      ------------------atgtttaacttgcatggcgtgttaaatggggc
A0A3Q9HK78_E1B19K-      ------------------atgtttaacttgcatggcgtgttaaatggggc
A0A3Q9HK00_E1B19K-      ------------------atgtttaacttgcatggcgtgttaaatggggc
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ------------------atgtttaacttgcatggcgtgttatatgggac
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      -------------------------atgaagaggcctgtggctgcagaag
A0A1W5PVU4_E1B19K-      ----------------------atgatgaagaggcctgtggctgcagaag
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      gaggtataaagggagcggctttcaggctagaggcatttacccactagccg
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        gaggtataaagggagcggctttcaggctagaggcatttacccactagccg
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        gaggtataaagggagcggccgtggggttggggcatttcacc---------
F2WTM9_E1B19K-01        gaggtataaagggagcggccgtggggttggggcatttcacc---------
A0A1C8EG46_E1B19K-      gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        gaggtataaagggagtggtggtgaggttggggcatttcacc---------
H9AAN8_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAS0_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAV3_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
H9AAY5_E1B19K-01        gaggtataaagggagcggtggtgaggttggggcatttcacc---------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      cctatataagtggcaacacctgggcacttgggcacagaccttcagggagt
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        cctatataagtggcaacacctgggcactggggcacagaccttcagggagt
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        cctatataagtggcaacacctgggcactcgggcacagaccttcagggagt
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        cctatataagtggcaacacctgggcactggggcacagaccttcaggaagt
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      tctatataagtggcaacacctgggcacttgggcacagaccttcagggagt
C5HDR2_E1B19K-01        tctatataagtggcaacacctgggcacttgggcacagaccttcagggagt
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      -------------------atgcgccgtgggctaatcttggttacatctg
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      ggggcttaaagggtatataatgcgccgtgggctaatcttggttacatttg
A0A3Q9HK78_E1B19K-      ggggcttaaagggtatataatgcgccgtgggctaatcttggttacatttg
A0A3Q9HK00_E1B19K-      ggggcttaaagggtatataatgcgccgtgggctaatcttggttacatttg
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gggccttttaggccatataatgcgccgtgggctaatcttggttacatctg
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      -----atggatcttgacagggtgttggagaattacaatagcttaagaaag
A0A0M3TH18_E1B19K-      tccaaatggagcttgacaggctgttagagaattataacagcttaagaagg
A0A1W5PVU4_E1B19K-      tccaaatggagcttgacaggctgttagagaattataacagtttaagaagg
A0A2H4CJZ0_E1B19K-      -----atggagttctggagtgagttgcagaactaccagagcctccggcac
H8PFZ1_E1B19K-01        -----atggagtactggagtgagctgcagaattaccagagcctccggcgc
G0ZAH2_E1B19K-01        -----atggatctcttgaagttcctggaagactttgagaattgcagacaa
F6KST6_E1B19K-01        -----atggacttgtacgagagtttagagaatcttggctctttgcggcgt
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        -----atggacttgtacgagagtctagagaatctaagttctttgcgacgt
Q695T5_E1B19K-01        -----atggacttgtacgagagcctagagaatctaagttctttgcgacgt
H9TER0_E1B19K-01        -----atggacttgtacgagagcctagagaatctaagttctttgcgacgt
A0A1L3INW0_E1B19K-      -----atggacttgtacaagagcttagaggatcgcagcactttgcgacag
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      ccttcatggatttgcgcgctgagttgcaaacttttgagagtacccggcgt
H9AAD9_E1B19K-01        -----atggatctgcgcgctgagctgcaaacttttgagagtacccggcgt
H9AAK5_E1B19K-01        ccttcatggatctgcgcgctgagctgcaaacttttgagagtacccggcgt
H9AAH3_E1B19K-01        -----atggatctgcgcgctgagctgcaaacttttgagagtacccggcgt
F2WTJ7_E1B19K-01        -----atggatctgcgagtggagctgcagacttttgagagtacccggtgc
F2WTM9_E1B19K-01        -----atgaatctgcgagtggagctgcagacttttgagagtacccggtgc
A0A1C8EG46_E1B19K-      -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
H9AAA8_E1B19K-01        -----atggatctgcgagtggagttgcaaacttttgagagtacccggtgc
H9AA76_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
H9AAN8_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
H9AAS0_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
H9AAV3_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
H9AAY5_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
M9YVA3_E1B19K-01        -----atggatctgcgagtggagttgcagacttttgagagtacccggtgc
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        -----atggatctcctaaggctgctcagcgattacgaggtgctgcgcaag
A0A0M3TH31_E1B19K-      -----atggatctcctaaggctgctcagtgattacgaggtgctgcgcaag
M9YXY5_E1B19K-01        -----atggatctcctaaggttgctcagtgattacgaggtgctgcgcaag
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        -----atggatctccgaacggcgcttcagacttttgagagcacccgccgc
A0A0M4N3Z1_E1B19K-      -----atggatctccgaacggcgcttcagacttttgagagcacccgccgc
Q8B6X5_E1B19K-01        -----atggatctccgaacggcgcttcagacttttgagagcacccgccgc
B9A5L5_E1B19K-01        -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
T1UGY3_E1B19K-01        -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
A0A1P7YYY5_E1B19K-      -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
A0A1P7YWY2_E1B19K-      -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
A0A1P7YWR9_E1B19K-      -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
A0A1P7YXN8_E1B19K-      -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
A0A1P8C849_E1B19K-      -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
B9A5A7_E1B19K-01        -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
T1UG22_E1B19K-01        -----atggatgtgtggagtattcttggggaatttaacaagacacgccgg
M0QVG6_E1B19K-01        -----atggaggtgtggactatccttgcagactttagcaagacacgccgg
X4YVU5_E1B19K-01        -----atggaggtgtggactatccttgcagactttagcaagacacgccgg
M0QUS9_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
M0QU02_E1B19K-01        -----atggatgtgtggactatccttgcggactttaacaagacacgccgg
A0A291B0H2_E1B19K-      -----atggatgtgtggactatccttggggactttagcaagacacgccgg
M0QV87_E1B19K-01        -----atggatgtgtggactatccttggggattttgtcaagacacgccgg
T1UKV6_E1B19K-01        -----atggatgtgtggactatccttggggattttaacaagacacgccgg
W8VNG2_E1B19K-01        -----atggaggtgtggactatccttggggactttaacaagacacgccgg
F8UFP5_E1B19K-01        -----atggaggtgtggactatccttgcagactttaacaagacacgccgg
T1UGT5_E1B19K-01        -----atggaggtgtggactatccttgcagactttaacaagacacgccgg
T1UGX3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagccagacacgccgg
W8CZB0_E1B19K-01        -----atggaggtgtggactatccttggagactttaacaagacacgccgg
G3CK71_E1B19K-01        -----atggaggtgtggactatccttggagactttaacaagacacgccgg
M0QTS5_E1B19K-01        -----atggaggtgtggactatccttgcagactttagcaagacacgccgg
M0QV08_E1B19K-01        -----atggaggtgtggactatccttgcagactttagcaagacacgccgg
G9JUV5_E1B19K-01        -----atggaggtgtggactatccttgcagactttagcaagacacgccgg
G1FC01_E1B19K-01        -----atggaggtgtggactatccttggagactttaacaagacacgccgg
A0A0G2UY10_E1B19K-      tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A1J0MS84_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QUJ3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
H0PPE7_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UKP8_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UHQ8_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
Q4KSL0_E1B19K-01        tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UHG3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A384ZUF2_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QUN2_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
E1CIM6_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
E1AI10_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
Q9YL99_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
K7ZLN6_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
E1CIR1_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A1Y1BXT7_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A8F5PHF8_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UHH6_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QVT4_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1ULJ8_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
E9P585_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
D4N3H6_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
C4P207_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1ULP4_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A384ZUM9_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
B9A5Q1_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QUB4_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QVK6_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A3G8WIY5_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
X4Y9D2_E1B19K-01        tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UHL7_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A075TSZ1_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
F1DT57_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A3Q9FFS0_E1B19K-      -----atggatgtgtggagtatccttgcagactttagcaagacacgccga
M0QUF3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
E5RWD9_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccga
E5RWL1_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccga
B6DU90_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccga
B9A5T7_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A7R6T9I9_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
B6C6W8_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
B9A681_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A1Y1BYF1_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UHZ2_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
B2VQE3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QU76_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QVC7_E1B19K-01        tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
M0QU41_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A097I4T0_E1B19K-      -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
A0A3S6PYX7_E1B19K-      tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
C5HDR2_E1B19K-01        tcctgatggatgtgtggactatccttgcagactttagcaagacacgccgg
D3GBW3_E1B19K-01        -----atggatgtgtggactatccttgcagactttagcaagacacgccgg
T1UK99_E1B19K-01        -----atggaggtgtggactatccttggggactttaacaagacacgccgg
G1FBW4_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
T1UKQ0_E1B19K-01        -----atggatgtgtggactatccttgcggactttaacaagacacgccgg
M0QVP5_E1B19K-01        -----atggatgtgtggactatccttgcggactttaacaagacacgccgg
H5T740_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
M0QUW8_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
E1CIJ0_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
T1UGU0_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
M0QV47_E1B19K-01        -----atggaggtgtggactatccttgcggactttaacaagacacgccgg
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
Q6WQ37_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
Q6VGV8_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A0G2R248_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7D0TN91_E1B19K-      acctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A5K6WAR5_E1B19K-      -----atggaggcttgggagtgtttggaagatttttttgctgtgcgtaac
A0A3S9SND6_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3S9SNH4_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A513TZR1_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7L4WK62_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A291P1B2_E1B19K-      -----atggagacttgggagtgtttggaagatttttctgctgtgcgtaac
T1UG63_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HJZ5_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A8F9W8V2_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3S9SP19_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A6M4W5T4_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7L4WG90_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A516UYM9_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
J9Z4H6_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A1U9ALK7_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A6M5E4Y6_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
P03247_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3G8W3H5_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
E1U5L6_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A516UYI9_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HJ54_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
J9Z5H0_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7L4WJT1_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7L4WIG2_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3S9SPV1_E1B19K-      acctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HK78_E1B19K-      acctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HK00_E1B19K-      acctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HJ63_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7D6TSN5_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A4P2SGW2_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A2H4PJ75_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7L4WGT1_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
J7I6T8_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
Q71BY5_E1B19K-04        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3S9SSS2_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
E1ARN8_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
J9Z4N4_E1B19K-01        -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3Q9HLF7_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A3S9SNY0_E1B19K-      -----atggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
A0A7D0TLU2_E1B19K-      acctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaac
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      gttgtagaagaggcgtctgagcagacgtctgggtggtggcgtaaactttt
A0A0M3TH18_E1B19K-      gttttagaagaggcgtctgaagatacttcagtttggtggcgcaagttgtt
A0A1W5PVU4_E1B19K-      gttttagaagaggcgtctgaggatacttcagtttggtggcgtaggctgtt
A0A2H4CJZ0_E1B19K-      ctgctggagttggcctctgccagaacatccacctgctggaggttctgttt
H8PFZ1_E1B19K-01        ctgctggagttggcctctgccagaacatccacctgctggaggttctgttt
G0ZAH2_E1B19K-01        gttttgcagcaggcgtccaagaggactgggggttggagccgctggctgct
F6KST6_E1B19K-01        ttgctagaggaggcttccgacagaacctcttacttttggaggtttctgtg
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        ctgctggaggaggcttccgacagaacctcttacatttggaggtttctgtt
Q695T5_E1B19K-01        ttgctggaggaggcctccgacagaacctcttacatttggaggtttctgtt
H9TER0_E1B19K-01        ttgctggaggaggcctccgacagaacctcttacatttggaggtttctgtt
A0A1L3INW0_E1B19K-      ctgctggaggaggcatccaactctacctcttactgctggaggtttttgtt
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      ttagtagagttgtgctccaacaggtcctcttggtttgggaggttcctgtt
H9AAD9_E1B19K-01        ttagtagagttgtgctccaacaggtcctcttggtttgggaggttcctgtt
H9AAK5_E1B19K-01        ttagtagagttgtgctccaacaggtcctcttggtttgggaggttcctgtt
H9AAH3_E1B19K-01        ttagtagagttgtgctccaacaggtcctcttggtttgggaggttcctgtt
F2WTJ7_E1B19K-01        ctgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
F2WTM9_E1B19K-01        ctgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
A0A1C8EG46_E1B19K-      ttgctagagctgtgctccaatcgagcctcttggtggaaaaggcttttgtt
H9AAA8_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaaaaggcttttgtt
H9AA76_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
H9AAN8_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
H9AAS0_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
H9AAV3_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
H9AAY5_E1B19K-01        ttgctggagctgtgctccaacagagcctcttggtggaagaggcttttgtt
M9YVA3_E1B19K-01        ttgctggagctgtgctccaacagagatccttggtggaagaggcttttgtt
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        ttgctggagacagcctgtgagaaaaatcgcagctgttggaggtttttctt
A0A0M3TH31_E1B19K-      ttgctggagacagcctgtgagaaaacttccagctgttggaggtttttctt
M9YXY5_E1B19K-01        ttgctggagacagcctgtgagaaaacttccagctgttggaggtttttctt
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        ttgctggagctctgttccaatagaacctcttttttgtggaggtggttatt
A0A0M4N3Z1_E1B19K-      ttgctggagctctgttccaatagaacctcttttttgtggaggtggttatt
Q8B6X5_E1B19K-01        ttgctggagctctgttccaatagaacctcttttttgtggaggtggttatt
B9A5L5_E1B19K-01        cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
T1UGY3_E1B19K-01        cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
A0A1P7YYY5_E1B19K-      cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
A0A1P7YWY2_E1B19K-      cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
A0A1P7YWR9_E1B19K-      cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
A0A1P7YXN8_E1B19K-      cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
A0A1P8C849_E1B19K-      cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
B9A5A7_E1B19K-01        cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
T1UG22_E1B19K-01        cttgtggaggatagttcagacgggtgctccgggttttggagacactggtt
M0QVG6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
X4YVU5_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QUS9_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
M0QU02_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggagacactggtt
A0A291B0H2_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QV87_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UKV6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
W8VNG2_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
F8UFP5_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UGT5_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggagacactggtt
T1UGX3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
W8CZB0_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttttggagacactggtt
G3CK71_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QTS5_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QV08_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
G9JUV5_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
G1FC01_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A0G2UY10_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A1J0MS84_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QUJ3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
H0PPE7_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UKP8_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UHQ8_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
Q4KSL0_E1B19K-01        cttgtagaggatagttcagacggatgctccgggttctggagacactggtt
T1UHG3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A384ZUF2_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QUN2_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E1CIM6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E1AI10_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
Q9YL99_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
K7ZLN6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E1CIR1_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A1Y1BXT7_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A8F5PHF8_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UHH6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QVT4_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1ULJ8_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E9P585_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
D4N3H6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
C4P207_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1ULP4_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A384ZUM9_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B9A5Q1_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QUB4_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QVK6_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A3G8WIY5_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
X4Y9D2_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UHL7_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A075TSZ1_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
F1DT57_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A3Q9FFS0_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QUF3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E5RWD9_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
E5RWL1_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B6DU90_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B9A5T7_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A7R6T9I9_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B6C6W8_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B9A681_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A1Y1BYF1_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UHZ2_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
B2VQE3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QU76_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QVC7_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
M0QU41_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A097I4T0_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
A0A3S6PYX7_E1B19K-      cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
C5HDR2_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
D3GBW3_E1B19K-01        cttgtagaggatagttcagacgggtgctccgggttctggagacactggtt
T1UK99_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
G1FBW4_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggaggcactggtt
T1UKQ0_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggagacactggtt
M0QVP5_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggagacactggtt
H5T740_E1B19K-01        cttgtagaggatagttcagacgggtgctccggtttctggagacactggtt
M0QUW8_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
E1CIJ0_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
T1UGU0_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
M0QV47_E1B19K-01        cttgtggaggatagttcagacgggtgctccggtttctggagacactggtt
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
Q6WQ37_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttctggaggtttctgtg
Q6VGV8_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A0G2R248_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7D0TN91_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggagggttctgtg
A0A5K6WAR5_E1B19K-      ttactggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3S9SND6_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3S9SNH4_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A513TZR1_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7L4WK62_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A291P1B2_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
T1UG63_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3Q9HJZ5_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A8F9W8V2_E1B19K-      ttgctgaaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3S9SP19_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A6M4W5T4_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7L4WG90_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A516UYM9_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
J9Z4H6_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A1U9ALK7_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A6M5E4Y6_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
P03247_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3G8W3H5_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
E1U5L6_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A516UYI9_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3Q9HJ54_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
J9Z5H0_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7L4WJT1_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7L4WIG2_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3S9SPV1_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3Q9HK78_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3Q9HK00_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A3Q9HJ63_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7D6TSN5_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A4P2SGW2_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A2H4PJ75_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
A0A7L4WGT1_E1B19K-      ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
J7I6T8_E1B19K-01        ttgctggaacagagctctaacagtacctcttggttttggaggtttctgtg
Q71BY5_E1B19K-04        ttgctggaacagagctctaacagtacctcctggttttggaggtttctgtg
A0A3S9SSS2_E1B19K-      ttgctggaacagagctctaacagtacctcctggttttggaggtttctgtg
E1ARN8_E1B19K-01        ttgctggaacagagctctaacagtacctcctggttttggaggtttctgtg
J9Z4N4_E1B19K-01        ttgttggaacagagctctaacagtacctcctggttttggaggtttctgtg
A0A3Q9HLF7_E1B19K-      ttgctggaacagagctctaacagtacctcctggttttggaggtttctgtg
A0A3S9SNY0_E1B19K-      ttgctggaacagagctctaacagtacctcctggttttggaggtttctgtg
A0A7D0TLU2_E1B19K-      ttgctggaacagagctctaacagtacctccaaaaccaagaggttactgtt
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      tgggtgtaggttaagttgcttggtggtgcaagcaaagtttgagtacaggg
A0A0M3TH18_E1B19K-      tgggtgtagagttagtcagttagtagttcaggctaaagttgaatataagg
A0A1W5PVU4_E1B19K-      tgggtgtagggttagtcagttagtagtgcaggctaaagttgaatataagg
A0A2H4CJZ0_E1B19K-      tggctcgactcttagtaacgtggtgtatcgggtgaagcaagagtacagct
H8PFZ1_E1B19K-01        tggctcgactctcagtaacgtggtgtatcgggtgaagcaagagtacagct
G0ZAH2_E1B19K-01        tggcaatcagctggttcgcacggtcgctcaggtcaagacagactatagcg
F6KST6_E1B19K-01        cggttctcctctaagccgctttttaaaccgggtaaagcgagaacaccgag
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        cggttcccctctgagtcgctttttgtaccgggtgaagcgagagcacctga
Q695T5_E1B19K-01        cggttcccctctgagtcgctttctttaccgggtgaagcgagagcacctga
H9TER0_E1B19K-01        cggttcccctctgagtcgctttttgcaccgggtgaagcgagagcacctga
A0A1L3INW0_E1B19K-      tggatcccctctgggtcgctttttgtaccgggttaagaaggatcatcagg
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      tggaagcaccctctgccgggtggtaaggcaggtgaaggaggagtatcaga
H9AAD9_E1B19K-01        tggaagcactctctgccgggtggtaaggcaggtgaaggaggagtatcaga
H9AAK5_E1B19K-01        tggaagcactctctgccgggtggtaaggcaggtgaaggaggagtatcaga
H9AAH3_E1B19K-01        tggaagcactctctgccgggtggtaaggcaggtgaaggaggagtatcaga
F2WTJ7_E1B19K-01        tggtacttctctgtgccggttagtgaggcaggtgaaggaagagtacgaga
F2WTM9_E1B19K-01        tggtacttctctgtgccggttagtgaggcaggtgaaggaagagtacgaga
A0A1C8EG46_E1B19K-      tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
H9AAA8_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtaaaggaagagtaccaaa
H9AA76_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
H9AAN8_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
H9AAS0_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
H9AAV3_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
H9AAY5_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
M9YVA3_E1B19K-01        tggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccaga
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        tggctctactcttagcaacgtggtgcacagagtcaagcgagagcacagtg
A0A0M3TH31_E1B19K-      tggctctactcttagcaacgtggtgcacagagtcaagcgagagcacagtg
M9YXY5_E1B19K-01        tggctctactcttagcaacgtggtgcacagagtcaagcgagagcacagtg
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        tggaactccgctcagccggctggttaggcaggtgaaattagaatacgaga
A0A0M4N3Z1_E1B19K-      tggaactccgctcagtcggctggttaggcaggtgaaattagaatacgaga
Q8B6X5_E1B19K-01        tggaactccgctcagtcggctggttaggcaggtgaaattagaatacgaga
B9A5L5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
T1UGY3_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaaaaaggattatagcg
A0A1P7YYY5_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
A0A1P7YWY2_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
A0A1P7YWR9_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
A0A1P7YXN8_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
A0A1P8C849_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
B9A5A7_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
T1UG22_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
M0QVG6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
X4YVU5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
M0QUS9_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
M0QU02_E1B19K-01        tggaactcctctatctcgcctggtgtacacagtaaagaaggattatcagg
A0A291B0H2_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
M0QV87_E1B19K-01        tggaactcctttatctcgcctggtgtacacagttaagaaggattatagcg
T1UKV6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
W8VNG2_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
F8UFP5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatagcg
T1UGT5_E1B19K-01        tggaactcctctatctcgcctggtgtatacagttaagaaggattataacg
T1UGX3_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
W8CZB0_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
G3CK71_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
M0QTS5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
M0QV08_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
G9JUV5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
G1FC01_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
A0A0G2UY10_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
A0A1J0MS84_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
M0QUJ3_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
H0PPE7_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
T1UKP8_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
T1UHQ8_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaaaaaggattataacg
Q4KSL0_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
T1UHG3_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
A0A384ZUF2_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
M0QUN2_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
E1CIM6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
E1AI10_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
Q9YL99_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
K7ZLN6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
E1CIR1_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
A0A1Y1BXT7_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
A0A8F5PHF8_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
T1UHH6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
M0QVT4_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
T1ULJ8_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
E9P585_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
D4N3H6_E1B19K-01        tggaactcctctatctcgcctggtgtatacagttaagaaggattataaag
C4P207_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
T1ULP4_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
A0A384ZUM9_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
B9A5Q1_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
M0QUB4_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
M0QVK6_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
A0A3G8WIY5_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
X4Y9D2_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
T1UHL7_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
A0A075TSZ1_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataaag
F1DT57_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaaaaaggattataacg
A0A3Q9FFS0_E1B19K-      tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
M0QUF3_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
E5RWD9_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
E5RWL1_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
B6DU90_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
B9A5T7_E1B19K-01        tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
A0A7R6T9I9_E1B19K-      tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
B6C6W8_E1B19K-01        tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
B9A681_E1B19K-01        tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
A0A1Y1BYF1_E1B19K-      tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
T1UHZ2_E1B19K-01        tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
B2VQE3_E1B19K-01        tggaactcctctatctcgactggtgtacacagttaagaaggattataacg
M0QU76_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
M0QVC7_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
M0QU41_E1B19K-01        tggaactcctctatctcgtctggtgtacacagttaagaaggattataacg
A0A097I4T0_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
A0A3S6PYX7_E1B19K-      tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
C5HDR2_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
D3GBW3_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattataacg
T1UK99_E1B19K-01        tggaactcctctatctcgcctggtgtacactgttaagaaggattatcagg
G1FBW4_E1B19K-01        tggatctcctctatctcgcctggtgtacactgttaagaaggattatcagg
T1UKQ0_E1B19K-01        tggatctcctctatctcgcctggtgtacactgttaagaaggattatcagg
M0QVP5_E1B19K-01        tggaactcctctatctcgcctggtgtacacagttaagaaggattatcagg
H5T740_E1B19K-01        tggaactcctctagctcgcctggtgtacactgttaagaaggattatcagg
M0QUW8_E1B19K-01        tggaactcctctagctcgcctggtgtacacagttaagaaggattatcagg
E1CIJ0_E1B19K-01        tggaactcctctagctcgtctggtgtacacagttaagaaggattatcagg
T1UGU0_E1B19K-01        tggaactcctctagctcgtctggtgtacacagttaagaaggattatcagg
M0QV47_E1B19K-01        tggaactcctctagctcgcctggtgtacacagttaagaaggattatcagg
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      gggctcctcccaggcaaagttagtttgcagaattaaggaggattacaagt
Q6WQ37_E1B19K-01        gggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagt
Q6VGV8_E1B19K-01        gggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A0G2R248_E1B19K-      gggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7D0TN91_E1B19K-      gggctcctcccaggcaaagttagtttgcagaattaaggaggattacaagt
A0A5K6WAR5_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3S9SND6_E1B19K-      gggctcctcccaggcaaagttagtctgcagagttaaggaggattacaagt
A0A3S9SNH4_E1B19K-      gggctcctcccaggcaaagttagtctgcagagttaaggaggattacaagt
A0A513TZR1_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7L4WK62_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A291P1B2_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
T1UG63_E1B19K-01        gggctcctcccaggcaaagttagtttgcagaattaaggaggattacaagt
A0A3Q9HJZ5_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A8F9W8V2_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3S9SP19_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A6M4W5T4_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7L4WG90_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A516UYM9_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
J9Z4H6_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A1U9ALK7_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A6M5E4Y6_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
P03247_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3G8W3H5_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
E1U5L6_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A516UYI9_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3Q9HJ54_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
J9Z5H0_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7L4WJT1_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7L4WIG2_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3S9SPV1_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3Q9HK78_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3Q9HK00_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3Q9HJ63_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7D6TSN5_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A4P2SGW2_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A2H4PJ75_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7L4WGT1_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
J7I6T8_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
Q71BY5_E1B19K-04        gggctcctcccaagcaaagttagtctgcagaattaaggaggattacaagt
A0A3S9SSS2_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
E1ARN8_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
J9Z4N4_E1B19K-01        gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3Q9HLF7_E1B19K-      gggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A3S9SNY0_E1B19K-      gggctcctgccaggcaaagttagtctgcagaattaaggaggattacaagt
A0A7D0TLU2_E1B19K-      gagctctttccagccaaagttagtctgcagaattaaggaggattacaagt
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      aagaatttgagaggttatttgcggaggtgcctggacttttagaatcttta
A0A0M3TH18_E1B19K-      aagaatttgagaaacttttttcagaggtgcctggacttgtggactctcta
A0A1W5PVU4_E1B19K-      aagaatttgagaaacttttttcggaagtgcctggacttgtggactctttg
A0A2H4CJZ0_E1B19K-      cgcgcttttctgagctgttggcccgctacccggctgtttttgcttctctg
H8PFZ1_E1B19K-01        cgcgcttttctgagctgttggcccgctacccggctgtttttgtttctctg
G0ZAH2_E1B19K-01        agcatttcgagcagcttttgcaggagcagaaccgacttctgctgaacaac
F6KST6_E1B19K-01        ctgaatttgatgaacttttagagcatttacctgggctttttgattctttg
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        cggaatttgatgggcttttagagcagctgcctgggctgtttgattctttg
Q695T5_E1B19K-01        cggaatttgatgggcttttagagcagctgcctgggctgtttgattctttg
H9TER0_E1B19K-01        cggaatttgatgggcttttagagcagctgcctggactgtttgattctttg
A0A1L3INW0_E1B19K-      aggaatttgatcagttaattggtctttttcctactattttcgagtctctt
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      gcgagtttgaacacattctttccaactgccctgggctttttgtgtctctg
H9AAD9_E1B19K-01        gcgagtttgaacacattctttccaactgccctgggctttttgtgtctttg
H9AAK5_E1B19K-01        gcgagtttgaacacattctttccaactgccctgggctttttgtgtctttg
H9AAH3_E1B19K-01        gcgagtttgaacacattctttccaactgccctgggctttttgtgtctttg
F2WTJ7_E1B19K-01        gcgagtttgagcatattctctcgacctgccaggggcttttcgagtctctg
F2WTM9_E1B19K-01        gcgagtttgagcatattctctcgacctgccaggggcttttcgagtctctg
A0A1C8EG46_E1B19K-      gcgagtttgagcatattctctccacctgccaggggctttttgagtctctg
H9AAA8_E1B19K-01        gcgagtttgagcacattctctccacctgccaggggcttttcgagtctctg
H9AA76_E1B19K-01        gcgagtttgagcatattctctccacctgccaggggcttttcgagtctctg
H9AAN8_E1B19K-01        gcgagtttgagcatattctttccacttgccaggggcttttcgagtctctg
H9AAS0_E1B19K-01        gcgagtttgagcatattctttccacttgccaggggcttttcgagtctctg
H9AAV3_E1B19K-01        gcgagtttgagcatattctttccacttgccaggggcttttcgagtctctg
H9AAY5_E1B19K-01        gcgagtttgagcatattctttccacttgccaggggcttttcgagtctctg
M9YVA3_E1B19K-01        gcgagtttgagcatattctttccacttgccaggggcttttcgagtctctg
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        aagaattttctagactagtggcagatgttcccgggctttttgtttcttta
A0A0M3TH31_E1B19K-      aggaattttctagactagtggcagatgttcccgggctttttgtttcttta
M9YXY5_E1B19K-01        aggaattttctagactagtggcagatgttcccgggctttttgtttcttta
Q71BY5_E1B19K-01        ----atgagacatattatttgcc---------------------------
Q71BY5_E1B19K-02        ----atgagacatattatttgcc---------------------------
Q71BY5_E1B19K-03        ----atgagacatattatttgcc---------------------------
P06501_E1B19K-01        aggattttgaaagaattttagatcagtgtcccggggtgtttgagtccctg
A0A0M4N3Z1_E1B19K-      aggattttgaaagaattttagatcaatgtcccggggtgtttgagtccctg
Q8B6X5_E1B19K-01        aggattttgaaagaattttagatcaatgtcccggggtgtttgagtccctg
B9A5L5_E1B19K-01        aggaatttgaaaatctttttgccgactgttctggcctgctagattcttta
T1UGY3_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgctagattcttta
A0A1P7YYY5_E1B19K-      aggaatttgaaaatctttttgccgactgctctggcctgctagattcttta
A0A1P7YWY2_E1B19K-      aggaatttgaaaatatttttgccgactgctcttgcctgctagattcttta
A0A1P7YWR9_E1B19K-      aggaatttgaaaatatttttgccgactgctctggcctgctagattcttta
A0A1P7YXN8_E1B19K-      aggaatttgaaaatatttttgccgactgctcttgcctgctagattcttta
A0A1P8C849_E1B19K-      aggaatttgaaaatctttttgccgactgctctggcctgctagattcttta
B9A5A7_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgctagattcttta
T1UG22_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgctagattcttta
M0QVG6_E1B19K-01        aggaatttgaaaatctttttgtcgactgctctggcctgctagattctctg
X4YVU5_E1B19K-01        aggaatttgaaaatctttttgtcgactgctctggcctgctagattctctg
M0QUS9_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgctagattctctg
M0QU02_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgcttgattctctg
A0A291B0H2_E1B19K-      aggaatttgaaaatcttttttccgactgctctggcctgctagattctctg
M0QV87_E1B19K-01        aggaatttgaaaatcttttttccgactgctctggcctgctagattctctg
T1UKV6_E1B19K-01        aggaatttgaaaatcttttttccgactgctctggcctgctagattctctg
W8VNG2_E1B19K-01        aggaatttgaaaatcttttttccgactgctctggcctgcttgattcactg
F8UFP5_E1B19K-01        aggaatttgaaaatcttttttccgactgctctggcctgcttgattcactg
T1UGT5_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
T1UGX3_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
W8CZB0_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgcttgattctctg
G3CK71_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctttg
M0QTS5_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
M0QV08_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
G9JUV5_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
G1FC01_E1B19K-01        aggaatttgaaaatctttttgccgactgctctggcctgcttgattctctg
A0A0G2UY10_E1B19K-      aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
A0A1J0MS84_E1B19K-      aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
M0QUJ3_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
H0PPE7_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
T1UKP8_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
T1UHQ8_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
Q4KSL0_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
T1UHG3_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
A0A384ZUF2_E1B19K-      aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
M0QUN2_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
E1CIM6_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
E1AI10_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
Q9YL99_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
K7ZLN6_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
E1CIR1_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
A0A1Y1BXT7_E1B19K-      aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
A0A8F5PHF8_E1B19K-      aggaatttgaaaatatttttgctgactgctctggcctgctagattctctg
T1UHH6_E1B19K-01        aggaatttgaaaatatttttgctgactgctctggtctgctagattctctg
M0QVT4_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgttagattctctg
T1ULJ8_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggtctgctagattctctg
E9P585_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggtctgctagattctctg
D4N3H6_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggtctgctagattctctg
C4P207_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggtctgctagattctctg
T1ULP4_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggtctgctagattctctg
A0A384ZUM9_E1B19K-      aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
B9A5Q1_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
M0QUB4_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
M0QVK6_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
A0A3G8WIY5_E1B19K-      aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
X4Y9D2_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
T1UHL7_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
A0A075TSZ1_E1B19K-      aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
F1DT57_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
A0A3Q9FFS0_E1B19K-      aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
M0QUF3_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctcta
E5RWD9_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
E5RWL1_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
B6DU90_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
B9A5T7_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
A0A7R6T9I9_E1B19K-      aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
B6C6W8_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
B9A681_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
A0A1Y1BYF1_E1B19K-      aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
T1UHZ2_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
B2VQE3_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
M0QU76_E1B19K-01        aggaaattgaaaatctttttgctgattgctctggcctgctagattctctg
M0QVC7_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
M0QU41_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctgctagattctctg
A0A097I4T0_E1B19K-      aggaatttgaaaatctttttgctgattgctctggcctactagattctctg
A0A3S6PYX7_E1B19K-      aggaatttgaaaatctttttgctgattgctctggcctactagattctctg
C5HDR2_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctactagattctctg
D3GBW3_E1B19K-01        aggaatttgaaaatctttttgctgattgctctggcctactagattctctg
T1UK99_E1B19K-01        aggaatttgaaaatctttttgctgactgctctggcctgctagattctctg
G1FBW4_E1B19K-01        aggaatttgaaaatctttttgccgattgctctggcctgcttgattcactg
T1UKQ0_E1B19K-01        aggaatttgaaaatctttttgccgattgctctggcctgcttgattcactg
M0QVP5_E1B19K-01        aggaatttgaaaatctttttgccgactgttctggcctgcttgattcactg
H5T740_E1B19K-01        acgaatttgaaaatctttttgctgactgttctggccttcttgattcactg
M0QUW8_E1B19K-01        aggaatttgaaaatctttttgccgattgctctggcctgctcgattcactg
E1CIJ0_E1B19K-01        aggaatttgaaaatctttttgccgactgttctggccttcttgattcactg
T1UGU0_E1B19K-01        aggaatttgaaaatctttttgccgactgttctggccttcttgattcactg
M0QV47_E1B19K-01        aggaatttgaaaatctttttgccgactgttctggccttcttgattcactg
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
Q6WQ37_E1B19K-01        gggaattcgaagagcttttgaagtcctgtggtgagctgtttgattctttg
Q6VGV8_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A0G2R248_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7D0TN91_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A5K6WAR5_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SND6_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SNH4_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A513TZR1_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7L4WK62_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A291P1B2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
T1UG63_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HJZ5_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A8F9W8V2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SP19_E1B19K-      gggaatttgaagatcttttgaaatcctgtggtgagctgtttgattctttg
A0A6M4W5T4_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7L4WG90_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A516UYM9_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
J9Z4H6_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A1U9ALK7_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A6M5E4Y6_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
P03247_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3G8W3H5_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
E1U5L6_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A516UYI9_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HJ54_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
J9Z5H0_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7L4WJT1_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7L4WIG2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SPV1_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HK78_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HK00_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HJ63_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7D6TSN5_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A4P2SGW2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A2H4PJ75_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7L4WGT1_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
J7I6T8_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
Q71BY5_E1B19K-04        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SSS2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
E1ARN8_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
J9Z4N4_E1B19K-01        gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3Q9HLF7_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A3S9SNY0_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
A0A7D0TLU2_E1B19K-      gggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttg
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        ---atgagtggaaacgcttcttttaaggggggagtcttcagccctt----
Q6RK98_E1B19K-03        ---atgagtggaagcgcttcttttgaggggggagtatttagccctt----
A0A097IW62_E1B19K-      aatttttgccatcacgctgtgttttatgagaaaataatttgctctttaga
A0A0M3TH18_E1B19K-      aatttttgccatcacgcttttttttacgagaaggttatttgcggcttgga
A0A1W5PVU4_E1B19K-      aatttttgccatcacgcttttttttacgagaaggttatttgcggcttgga
A0A2H4CJZ0_E1B19K-      gatctaggccatcacgtttattttcaagaagcggtggtcagatatttgga
H8PFZ1_E1B19K-01        gatctaggccatcacgtttatttccaagaagctgtagtcagatatttgga
G0ZAH2_E1B19K-01        ttggaactcggtcacaccagggcactgaacggtgtgctgagggaactgga
F6KST6_E1B19K-01        aatctaggccatcgggtattgcttgaggaaaggctttttccacaattgga
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        aatctcggccaccggacgctgctagaggagaggctttttccacaattgga
Q695T5_E1B19K-01        aatctcggccaccggacgctgctagaggagaggctttttccacaattgga
H9TER0_E1B19K-01        aatctcggccaccggacgctgctagaggagaggctttttccacaattgga
A0A1L3INW0_E1B19K-      aacctcggtcacaaaactcttctcgaggataagctcctggtgcagttgga
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      gatctgggccaccatacggtgtttcaggagaagattgtgaaggctttaga
H9AAD9_E1B19K-01        gatctgggccaccatacggtgtttcaggagaagattgtgaaggctttaga
H9AAK5_E1B19K-01        gatctgggccaccatacggtgtttcaggagaagattgtgaaggctttaga
H9AAH3_E1B19K-01        gatctgggccaccatacggtgtttcaggagaagattgtgaaggctttaga
F2WTJ7_E1B19K-01        gagttgggacaccacacggtgtttcaggagaagattgtgaaggctttgga
F2WTM9_E1B19K-01        gagttgggacaccacacggtgtttcaggagaagattgtgaaggctttgga
A0A1C8EG46_E1B19K-      gagttgggacaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AAA8_E1B19K-01        gagttgggacaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AA76_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AAN8_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AAS0_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AAV3_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
H9AAY5_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
M9YVA3_E1B19K-01        gagttgggtcaccacacggtgtttcaggagaaaattgtgaaggctttgga
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        gatttaggacatcactcttactttcaggagaagattgtcaagggtctagt
A0A0M3TH31_E1B19K-      gacttaggacatcactcttactttcaggagaaaattgtaaagggtctagt
M9YXY5_E1B19K-01        gacttaggacatcactcttactttcaggagaaaattgtaaagggtctagt
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        gagctgggctatcataaggtttttgaggagaagattgtaaaggagttgga
A0A0M4N3Z1_E1B19K-      gagttgggctatcataaggtttttgaggataagattgtaaaggagttgga
Q8B6X5_E1B19K-01        gagttgggctatcataaggtttttgaggataagattgtaaaggagttgga
B9A5L5_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UGY3_E1B19K-01        aattttggtcaccagtcccttttccaggaaagggtactccacagccttga
A0A1P7YYY5_E1B19K-      aattttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1P7YWY2_E1B19K-      aattttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1P7YWR9_E1B19K-      aattttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1P7YXN8_E1B19K-      aattttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1P8C849_E1B19K-      aattttggccaccagtcccttttccaggaaagggtactccacagccttga
B9A5A7_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UG22_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QVG6_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtactccacagccttga
X4YVU5_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtactccacagccttga
M0QUS9_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtcctccacagccttga
M0QU02_E1B19K-01        aatttcggccaccagtcccttttccaggaaagggtcctccacagccttga
A0A291B0H2_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QV87_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtccttcacagccttga
T1UKV6_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtccttcacagccttga
W8VNG2_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
F8UFP5_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
T1UGT5_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
T1UGX3_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
W8CZB0_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctgcacagccttga
G3CK71_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
M0QTS5_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
M0QV08_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
G9JUV5_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
G1FC01_E1B19K-01        aattttggccaccagtcccttttccaggaaagggtcctccacagccttga
A0A0G2UY10_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagtcttga
A0A1J0MS84_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagtcttga
M0QUJ3_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
H0PPE7_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UKP8_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtacttcacagccttga
T1UHQ8_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
Q4KSL0_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UHG3_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A384ZUF2_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QUN2_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
E1CIM6_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
E1AI10_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
Q9YL99_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
K7ZLN6_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
E1CIR1_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1Y1BXT7_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A8F5PHF8_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UHH6_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QVT4_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1ULJ8_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtactccacagccttga
E9P585_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
D4N3H6_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
C4P207_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1ULP4_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A384ZUM9_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
B9A5Q1_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QUB4_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
M0QVK6_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A3G8WIY5_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtacttcacagccttga
X4Y9D2_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
T1UHL7_E1B19K-01        aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
A0A075TSZ1_E1B19K-      aatcttggccaccagtcccttttccaggaaagggtactccacagccttga
F1DT57_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
A0A3Q9FFS0_E1B19K-      aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
M0QUF3_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
E5RWD9_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
E5RWL1_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
B6DU90_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
B9A5T7_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
A0A7R6T9I9_E1B19K-      aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
B6C6W8_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
B9A681_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
A0A1Y1BYF1_E1B19K-      aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
T1UHZ2_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
B2VQE3_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
M0QU76_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
M0QVC7_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
M0QU41_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
A0A097I4T0_E1B19K-      aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
A0A3S6PYX7_E1B19K-      aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
C5HDR2_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
D3GBW3_E1B19K-01        aatctcggccaccagtcccttttccaggaaagggtactccacagccttga
T1UK99_E1B19K-01        aatttcggccaccagtcccttttccaggaaagggtactccacagccttga
G1FBW4_E1B19K-01        aatctcggccaccaggctcttttccaggaaagggtactccacagccttga
T1UKQ0_E1B19K-01        aatctcggccaccaggctcttttccaggaaagggtactccacagccttga
M0QVP5_E1B19K-01        aatctcggccaccaggctctattccaggaaagggtcctccacagccttga
H5T740_E1B19K-01        aatctcggccaccaggctctattccaggaaagggtcctccacagccttga
M0QUW8_E1B19K-01        aatctcggccaccaggctcttttccaggaaagggtcctccacagccttga
E1CIJ0_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtcctccacagccttga
T1UGU0_E1B19K-01        aatcttggccaccaggctctattccaggaaagggtcctccacagccttga
M0QV47_E1B19K-01        aatctcggccaccaggctctattccaggaaagggtcctccacagccttga
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
Q6WQ37_E1B19K-01        aatctgggtcaccaggcgcttctccaagagaaggtcatcaagactttgga
Q6VGV8_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A0G2R248_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7D0TN91_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A5K6WAR5_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SND6_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SNH4_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A513TZR1_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7L4WK62_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A291P1B2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcattaagactttgga
T1UG63_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HJZ5_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A8F9W8V2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SP19_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A6M4W5T4_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7L4WG90_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A516UYM9_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
J9Z4H6_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A1U9ALK7_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A6M5E4Y6_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
P03247_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3G8W3H5_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
E1U5L6_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A516UYI9_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HJ54_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
J9Z5H0_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7L4WJT1_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7L4WIG2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SPV1_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HK78_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HK00_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HJ63_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7D6TSN5_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A4P2SGW2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A2H4PJ75_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7L4WGT1_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
J7I6T8_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
Q71BY5_E1B19K-04        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SSS2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
E1ARN8_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
J9Z4N4_E1B19K-01        aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3Q9HLF7_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A3S9SNY0_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
A0A7D0TLU2_E1B19K-      aatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttgga
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      tttttgcaccccgggacggactattgcagctttggcattttgtacttata
A0A0M3TH18_E1B19K-      tttttgcactcccggacgcactattgcagctttggctttttgcgctttta
A0A1W5PVU4_E1B19K-      tttttgtactcctggacgcactattgcagctttggctttttgtgctttta
A0A2H4CJZ0_E1B19K-      tttttctactcccggtcgcacggtttctgcgcttgccttcatctgctttg
H8PFZ1_E1B19K-01        tttttctactcccgggcgtgcggtttctgcgattgccttcatctgctttg
G0ZAH2_E1B19K-01        ctttgagaatacgggacgggtggtagctggtcttgctttcctcgcgtacc
F6KST6_E1B19K-01        cttttcttctcccggtcgtctgtgttcagctcttgcgtttgtggttcatc
Q695T5_E1B19K-02        --------------------------------------------------
F2WTG5_E1B19K-01        cttctcctctccaggccgtctgtgttcagcgcttgcttttgctgtacatc
Q695T5_E1B19K-01        cttttcctctccaggccgtctgtgttccgcgcttgcttttgctgtacatc
H9TER0_E1B19K-01        cttttcctctccaggccgtctgtgttcagcgcttgcttttgctgtacatc
A0A1L3INW0_E1B19K-      tttttcaactccaggacgcgcctgttcaggtcttgcctttgttgtgcatt
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      tttttcttctccgggcagagccgttgcggctattgcttttgccgcctttt
H9AAD9_E1B19K-01        tttttcttctccgggcagagccgttgcggctattgcttttgccgcctttt
H9AAK5_E1B19K-01        tttttcttctccgggcagagccgttgcggctattgcttttgccgcctttt
H9AAH3_E1B19K-01        tttttcttctccgggcagagccgttgcggctattgcttttgccgcctttt
F2WTJ7_E1B19K-01        tttttcctctccgggcagggcagttgcggccattgcttttgccgccttta
F2WTM9_E1B19K-01        tttttcctctccgggcagggcagttgcggccattgcttttgccgccttta
A0A1C8EG46_E1B19K-      tttttcctctccgggcagggcagttgcggccattgcttttgccgccttta
H9AAA8_E1B19K-01        tttttcctctccgggcagggcagttgcggccatcgcttttgccgccttta
H9AA76_E1B19K-01        tttttcctctccgggcagggcagtcgcggccatcgcttttgccgccttta
H9AAN8_E1B19K-01        tttttcctctccgggcagggcagtcgcggccattgcttttgccgccttta
H9AAS0_E1B19K-01        tttttcctctccgggcagggcagtcgcggccattgcttttgccgccttta
H9AAV3_E1B19K-01        tttttcctctccgggcagggcagtcgcggccattgcttttgccgccttta
H9AAY5_E1B19K-01        tttttcctctccgggcagggcagtcgcggccattgcttttgccgccttta
M9YVA3_E1B19K-01        tttttcctctccgggcagggcagtcgcggccattgcttttgccgccttta
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        gtttgagtcaactggccgcacggttgtgtctgtggcttttatctgttttc
A0A0M3TH31_E1B19K-      gtttgagtcaactggccgcacggttgtgtccgtggcttttatctgttttc
M9YXY5_E1B19K-01        gtttgagtcaactggccgcacggttgtgtccgtggcttttatctgttttc
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        tttttcttctcccggtcgggcggtcgcggctgtggcctttgcttcctacc
A0A0M4N3Z1_E1B19K-      tttttcttctcccggtcgggcggttgcggctgtagcctttgcttcctacc
Q8B6X5_E1B19K-01        tttttcttctcccggtcgggcggttgcggctgtagcctttgcttcctacc
B9A5L5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
T1UGY3_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
A0A1P7YYY5_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
A0A1P7YWY2_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
A0A1P7YWR9_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
A0A1P7YXN8_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
A0A1P8C849_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
B9A5A7_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
T1UG22_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttt
M0QVG6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcgtttgtggtgtttc
X4YVU5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcgtttgtggtgtttc
M0QUS9_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcttttgtggtttttc
M0QU02_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcatttgtggtttttc
A0A291B0H2_E1B19K-      tttttcatctcccgggcgcactacagccggggttgcttttgtggtttttc
M0QV87_E1B19K-01        tttttcaactcccgggcgcactacagccggggttgcttttgtggtttttc
T1UKV6_E1B19K-01        tttttcatctcccggacgcactacagccggggttgcttttgtggtttttc
W8VNG2_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
F8UFP5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UGT5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UGX3_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
W8CZB0_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
G3CK71_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QTS5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QV08_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
G9JUV5_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
G1FC01_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A0G2UY10_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A1J0MS84_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QUJ3_E1B19K-01        tttttccagtccagggcgcactacagccggggttgcttttgtggtttttc
H0PPE7_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UKP8_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UHQ8_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
Q4KSL0_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UHG3_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A384ZUF2_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QUN2_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
E1CIM6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
E1AI10_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
Q9YL99_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
K7ZLN6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
E1CIR1_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A1Y1BXT7_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A8F5PHF8_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UHH6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QVT4_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1ULJ8_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
E9P585_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
D4N3H6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
C4P207_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1ULP4_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A384ZUM9_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B9A5Q1_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QUB4_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QVK6_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A3G8WIY5_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
X4Y9D2_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UHL7_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A075TSZ1_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
F1DT57_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A3Q9FFS0_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QUF3_E1B19K-01        tttttcaagcccagggcgcactacagccggggttgcttttgtggtttttc
E5RWD9_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttgtgtggtttttc
E5RWL1_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B6DU90_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B9A5T7_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A7R6T9I9_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B6C6W8_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B9A681_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A1Y1BYF1_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UHZ2_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
B2VQE3_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QU76_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QVC7_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
M0QU41_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
A0A097I4T0_E1B19K-      tttttccagtccagggcgcactacagccggggttgcttttgtggtttttc
A0A3S6PYX7_E1B19K-      tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
C5HDR2_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
D3GBW3_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtttttc
T1UK99_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcatttgtggtgtttc
G1FBW4_E1B19K-01        tttttccagcccaggccgcactacagccggtgttgcatttgtggtgtttc
T1UKQ0_E1B19K-01        tttttccagcccaggtcgcactacagccggtgttgcatttgtggtgtttc
M0QVP5_E1B19K-01        tttttccagcccagggcgtactacagccggggttgcatttgtggtgtttc
H5T740_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcttttgtggtgtttc
M0QUW8_E1B19K-01        tttttccagcccagggcgcactacagccggggttgcttttgtggtgtttc
E1CIJ0_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcttttgtggtgtttc
T1UGU0_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcttttgtggtgtttc
M0QV47_E1B19K-01        tttttccagcccagggcgcactacagccggtgttgcttttgtggtgtttc
T1UGY3_E1B19K-02        --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
M0QU02_E1B19K-02        --------------------------------------------------
M0QUS9_E1B19K-02        --------------------------------------------------
M0QV47_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
M0QUW8_E1B19K-02        --------------------------------------------------
M0QVP5_E1B19K-02        --------------------------------------------------
G1FBW4_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-02        --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QVC7_E1B19K-02        --------------------------------------------------
M0QU76_E1B19K-02        --------------------------------------------------
M0QU41_E1B19K-02        --------------------------------------------------
M0QUJ3_E1B19K-02        --------------------------------------------------
M0QUF3_E1B19K-02        --------------------------------------------------
M0QTS5_E1B19K-02        --------------------------------------------------
M0QV08_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
G1FC01_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
F1DT57_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UHL7_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
C4P207_E1B19K-02        --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-02        --------------------------------------------------
E1AI10_E1B19K-02        --------------------------------------------------
M0QVK6_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
M0QVG6_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
W8CZB0_E1B19K-02        --------------------------------------------------
M0QUB4_E1B19K-02        --------------------------------------------------
M0QVT4_E1B19K-02        --------------------------------------------------
E9P585_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A7L4WIC2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
Q6WQ37_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
Q6VGV8_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A0G2R248_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7D0TN91_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A5K6WAR5_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SND6_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SNH4_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A513TZR1_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7L4WK62_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A291P1B2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
T1UG63_E1B19K-01        tttttccacaccggggcgcactgcggctgctgttgcttttttgagtttta
A0A3Q9HJZ5_E1B19K-      tttttccacaccggggcgcgttgcggctgctgttgcttttttgagtttta
A0A8F9W8V2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SP19_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A6M4W5T4_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7L4WG90_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A516UYM9_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
J9Z4H6_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A1U9ALK7_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A6M5E4Y6_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
P03247_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3G8W3H5_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
E1U5L6_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A516UYI9_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3Q9HJ54_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
J9Z5H0_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7L4WJT1_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7L4WIG2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SPV1_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3Q9HK78_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3Q9HK00_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3Q9HJ63_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7D6TSN5_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A4P2SGW2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A2H4PJ75_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7L4WGT1_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
J7I6T8_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
Q71BY5_E1B19K-04        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SSS2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
E1ARN8_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
J9Z4N4_E1B19K-01        tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3Q9HLF7_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A3S9SNY0_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
A0A7D0TLU2_E1B19K-      tttttccacaccggggcgcgctgcggctgctgttgcttttttgagtttta
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
Q6VGV8_E1B19K-02        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-02        --------------------------------------------------
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
T1UEX7_E1B19K-02        --------------------------------------------------
P04492_E1B19K-02        --------------------------------------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        ----------atctgacagggcgtctcccatcctgggcaggagttcgtca
Q6RK98_E1B19K-03        ----------atctgacgggcaggctcccaccatgggcaggagttcgtca
A0A097IW62_E1B19K-      ttttggataggtggaataaggaaaccca---tctgagtgctggtt-----
A0A0M3TH18_E1B19K-      ttttagataagtggaataaggagactca---tctcagtaaaggat-----
A0A1W5PVU4_E1B19K-      ttttagataagtggaataaggagactca---tctgagtagaggat-----
A0A2H4CJZ0_E1B19K-      tgctagatcgatggagcgcccaaacccg---cctgagcccggggt-----
H8PFZ1_E1B19K-01        tgctagatcgatggagcgcccaaacccg---cctgagcccggggt-----
G0ZAH2_E1B19K-01        tgctcgatcggtgggacgagaacagcgt---cctcagcccgggct-----
F6KST6_E1B19K-01        tgttagacagatggaacgagcagacgca---gctgagcccgggtt-----
Q695T5_E1B19K-02        ----------atggaacgagcagacgca---gctcagcccgggtt-----
F2WTG5_E1B19K-01        tgttggacagatggaacgagcagacgca---gctcagcccgggct-----
Q695T5_E1B19K-01        tgttggacagatggaacgagcagacgca---gctcagcccgggtt-----
H9TER0_E1B19K-01        tgttggacagatggaacgagcagacgca---gctcagcccgggtt-----
A0A1L3INW0_E1B19K-      tactggacagatggaaccaggagacgta---cctgagcccggggt-----
P10543_E1B19K-01        ----------atggag-----------------ttgtggag---------
A0A6M6AEV2_E1B19K-      ----------atggag-----------------ttgtggag---------
A0A142G3J2_E1B19K-      ----------atggag-----------------ttgtggag---------
A0A7U3RVU4_E1B19K-      ----------atggag-----------------ttgtggag---------
A0A482EVC6_E1B19K-      ----------atggagcgcccaaaccca---tctgtcggaggggt-----
A0A7U3RWV6_E1B19K-      ----------atggag-----------------ttttggag---------
A0A1S6ELT2_E1B19K-      ----------atggag-----------------ttttggag---------
A0A3G4W995_E1B19K-      ----------atggag-----------------ttttggag---------
A0A898KBW7_E1B19K-      ----------atggag-----------------ttttggag---------
A0A3G8W407_E1B19K-      ----------atggag-----------------ttttggag---------
F4ZCJ8_E1B19K-01        ----------atggag-----------------ttttggag---------
A0A6B9DS29_E1B19K-      ----------atggag-----------------ttttggag---------
A0A8G1GLF6_E1B19K-      ----------atggag-----------------ttttggag---------
B5SNR1_E1B19K-01        ----------atggag-----------------ttttggag---------
P10544_E1B19K-01        ----------atggag-----------------ttttggag---------
A0A482EVC6_E1B19K-      ----------atggag-----------------ttttggag---------
A0A898KBR0_E1B19K-      ----------atggag-----------------ttttggag---------
A0A898KBS1_E1B19K-      ----------atggag-----------------ttttggag---------
W0S1G8_E1B19K-01        ----------atggag-----------------ttttggag---------
A0A6M6AES6_E1B19K-      ----------atggag-----------------ttttggag---------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        ------atggagcaacagcg-acagcca---cctgtcgtgggagt-----
A0A0A1EUE4_E1B19K-      ------atgggaagtgagagcacatctg---cct----------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIL0_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIC5_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AI40_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AII9_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIN5_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIU0_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIS9_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
A0A2H5AIT6_E1B19K-      ------atgggaagtgagagcacagctg---cct----------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      tgctggatagatggaacgcccagaccca---gctgtccccggggt-----
H9AAD9_E1B19K-01        tgctggatagatggaacgcccagaccca---gctgtccccggggt-----
H9AAK5_E1B19K-01        tgctggatagatggaacgcccagaccca---gctgtccccggggt-----
H9AAH3_E1B19K-01        tgctggatagatggaacgcccagaccca---gctgtccccggggt-----
F2WTJ7_E1B19K-01        ttttggatagatggaacagccagaccca---gctgtccccggggt-----
F2WTM9_E1B19K-01        ttttggatagatggaacagccagaccca---gctgtccccggggt-----
A0A1C8EG46_E1B19K-      ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AAA8_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AA76_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AAN8_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AAS0_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AAV3_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
H9AAY5_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
M9YVA3_E1B19K-01        ttttggatagatggaacacccagaccca---gctgtccccggggt-----
Q6QPF3_E1B19K-01        ----------atgga-----------------------------------
Q6QPB7_E1B19K-01        ----------atgga-----------------------------------
Q6QPI9_E1B19K-01        ----------atgga-----------------------------------
G9G841_E1B19K-01        ----------atgga-----------------------------------
Q8UY91_E1B19K-01        ----------atgga-----------------------------------
P10406_E1B19K-01        ----------atgga-----------------------------------
Q5GFC7_E1B19K-02        ----------atgga-----------------------------------
A0A2R3WN62_E1B19K-      ----------atgga-----------------------------------
A0A3G9CMQ4_E1B19K-      ----------atgga-----------------------------------
Q5GFC7_E1B19K-01        ----------atgga-----------------------------------
Q5GFC8_E1B19K-01        ----------atgga-----------------------------------
Q6H1D7_E1B19K-01        ----------atgga-----------------------------------
A0A3G9JTX5_E1B19K-      ----------atgga-----------------------------------
Q2KSM8_E1B19K-02        ----------atgga-----------------------------------
A0A2R3WNP3_E1B19K-      ----------atgga-----------------------------------
A0A3G8W6L2_E1B19K-      ----------atgga-----------------------------------
A0A3G9K5X3_E1B19K-      ----------atgga-----------------------------------
Q2KSG6_E1B19K-01        ----------atgga-----------------------------------
Q2KSM8_E1B19K-01        ----------atgga-----------------------------------
A0A2R3WN16_E1B19K-      ----------atgga-----------------------------------
Q2KSG6_E1B19K-02        ----------atgga-----------------------------------
A0A2L1F392_E1B19K-      ----------atgga-----------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ----------atgga-----------------------------------
Q7T951_E1B19K-01        ----------atgga-----------------------------------
T1UE63_E1B19K-01        ----------atgga-----------------------------------
Q7T8D8_E1B19K-01        ----------atgga-----------------------------------
Q5UW22_E1B19K-01        ----------atgga-----------------------------------
Q8B8U7_E1B19K-01        ----------atgga-----------------------------------
Q32UI6_E1B19K-01        ----------atgga-----------------------------------
A0A7G5FB98_E1B19K-      ----------atgga-----------------------------------
A0A7G5F9T0_E1B19K-      ----------atgga-----------------------------------
J7H4R9_E1B19K-01        ----------atgga-----------------------------------
D2DM83_E1B19K-01        ----------atgga-----------------------------------
J7I6W7_E1B19K-01        ----------atgga-----------------------------------
C7SRS7_E1B19K-01        ----------atgga-----------------------------------
A0A7U3S1T6_E1B19K-      ----------atgga-----------------------------------
A0A7U3S224_E1B19K-      ----------atgga-----------------------------------
W6EIX6_E1B19K-01        ----------atgga-----------------------------------
A0A1L7NRH1_E1B19K-      ----------atgga-----------------------------------
Q3ZL02_E1B19K-01        ----------atgga-----------------------------------
T1UFS4_E1B19K-01        ----------atgga-----------------------------------
T2CI10_E1B19K-01        ----------atgga-----------------------------------
A0A0K0PX35_E1B19K-      ----------atgga-----------------------------------
A0A0K0PX99_E1B19K-      ----------atgga-----------------------------------
Q3ZKW2_E1B19K-01        ----------atgga-----------------------------------
Q2KRU2_E1B19K-01        ----------atgga-----------------------------------
K7NG43_E1B19K-01        ----------atgga-----------------------------------
Q2KS85_E1B19K-01        ----------atgga-----------------------------------
A0A0B4SJH1_E1B19K-      ----------atgga-----------------------------------
A0A075IQ70_E1B19K-      ----------atgga-----------------------------------
T1UIP3_E1B19K-01        ----------atgga-----------------------------------
R4HLE1_E1B19K-01        ----------atgga-----------------------------------
Q5EY83_E1B19K-01        ----------atgga-----------------------------------
Q2Y0J3_E1B19K-01        ----------atgga-----------------------------------
R4HMC6_E1B19K-01        ----------atgga-----------------------------------
A0A897JQR0_E1B19K-      ----------atgga-----------------------------------
I1V161_E1B19K-01        ----------atgga-----------------------------------
A0A5P8KYF0_E1B19K-      ----------atgga-----------------------------------
J7I6S4_E1B19K-01        ----------atgga-----------------------------------
A0A220VZ73_E1B19K-      ----------atgga-----------------------------------
P03248_E1B19K-02        ----------atgga-----------------------------------
Q6RK98_E1B19K-01        ----------atgga-----------------------------------
J7I6Q4_E1B19K-01        ----------atgga-----------------------------------
A0A8B0LCV0_E1B19K-      ----------atgga-----------------------------------
J7ID56_E1B19K-01        ----------atgga-----------------------------------
I6LEP5_E1B19K-01        ----------atgga-----------------------------------
A0A6M6AA96_E1B19K-      ----------atgga-----------------------------------
A0A8B0LD36_E1B19K-      ----------atgga-----------------------------------
A0A8B0LBX6_E1B19K-      ----------atgga-----------------------------------
A0A8B0L9Y2_E1B19K-      ----------atgga-----------------------------------
R4HLJ6_E1B19K-01        ----------atgga-----------------------------------
R4HLA0_E1B19K-01        ----------atgga-----------------------------------
Q2KSL3_E1B19K-01        ----------atgga-----------------------------------
A0A5J6CTQ0_E1B19K-      ----------atgga-----------------------------------
I6LES1_E1B19K-01        ----------atgga-----------------------------------
T1UF50_E1B19K-01        ----------atgaa-----------------------------------
Q7T8D8_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
Q32UI6_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
A0A7G5FB98_E1B19K-      ----------atggatcccgcagactca---tttcagcaggggat-----
J7I6W7_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
W6EIX6_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
Q3ZL02_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
T1UFS4_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
T1UE63_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
T1UJX4_E1B19K-02        ----------atggatcccgcagactca---tttcagcaggggat-----
T2CI10_E1B19K-02        ----------atggatcccacagaccca---cttcagcaagggat-----
Q2Y0J3_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
Q5EY83_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
J7ID56_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
I6LEP5_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
Q2KSL3_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
T1UF50_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
R4HLE1_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
P03248_E1B19K-03        ----------atggatccgccaaactca---cttcagcaagggat-----
Q6RK98_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
J7I6Q4_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
R4HMC6_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
I1V161_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
A0A5P8KYF0_E1B19K-      ----------atggatccgccaaactca---cttcagcaagggat-----
J7I6S4_E1B19K-02        ----------atggatccgccaaactca---cttcagcaagggat-----
A0A897JQR0_E1B19K-      ----------atggatccgccaaactca---cttcagcaagggat-----
K7NG43_E1B19K-02        ----------atggatccgccaaaccca---cttcagcaagggat-----
Q3ZKW2_E1B19K-02        ----------atggatccgacaaaccca---cttcagcaagggat-----
Q2KRU2_E1B19K-02        ----------atggatccgccaaaccca---cttcagcaagggat-----
T1UIP3_E1B19K-02        ----------atggatccgccaaaccca---cttcagcaagggat-----
Q2KS85_E1B19K-02        ----------atggatccgccaaaccca---cttcagcaagggat-----
A0A0B4SJH1_E1B19K-      ----------atggatccgccaaaccca---cttcagcaagggat-----
A0A075IQ70_E1B19K-      ----------atggatccgccaaaccca---cttcagcaagggat-----
M9YVF6_E1B19K-01        ttttggataaatggagcagcgacagcca---cctgtcgtgggatt-----
A0A0M3TH31_E1B19K-      ttttggataaatggagcagcgacagcca---cctgtcgtgggatt-----
M9YXY5_E1B19K-01        ttttggataaatggagcagcgacagcca---cctgtcgtgggatt-----
Q71BY5_E1B19K-01        ----------acggaggtgttattaccg----------aagaaat-----
Q71BY5_E1B19K-02        ----------acggaggtgttattaccg----------aagaaat-----
Q71BY5_E1B19K-03        ----------acggaggtgttattaccg----------aagaaat-----
P06501_E1B19K-01        tgctggatagatggaacacccggaccca---cctgtccccggggt-----
A0A0M4N3Z1_E1B19K-      tgctggatagatggaacacccggaccca---cctgtccccggggt-----
Q8B6X5_E1B19K-01        tgctggatagatggaacacccggaccca---cctgtccccggggt-----
B9A5L5_E1B19K-01        tggttgacaaatggagccaggacaccca---actaagcaggggct-----
T1UGY3_E1B19K-01        tggttgacaaatggagccaggacaccca---actaagcaggggct-----
A0A1P7YYY5_E1B19K-      tggttgacaaatggagccaggacaccca---actaagcaggggct-----
A0A1P7YWY2_E1B19K-      tggttgacaaatggagccaggacaccca---actaagcaggggct-----
A0A1P7YWR9_E1B19K-      tggttgacaaatggagccaggacaccca---actaagcaggggct-----
A0A1P7YXN8_E1B19K-      tggttgacaaatggagccaggacaccca---actaagcaggggct-----
A0A1P8C849_E1B19K-      tggttgacaaatggagccaggacaccca---actaagcaggggct-----
B9A5A7_E1B19K-01        tggttgacaaatggagccaggacaccca---actaagcaggggct-----
T1UG22_E1B19K-01        tggttgacaaatggagccaggacaccca---actaagcaggggct-----
M0QVG6_E1B19K-01        tggttgacaaatggagccagcaaaccca---tctgaccagggatt-----
X4YVU5_E1B19K-01        tggttgacaaatggagccagcaaaccca---tctgaccagggatt-----
M0QUS9_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
M0QU02_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A291B0H2_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggat-----
M0QV87_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
T1UKV6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
W8VNG2_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
F8UFP5_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
T1UGT5_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
T1UGX3_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
W8CZB0_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
G3CK71_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QTS5_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QV08_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
G9JUV5_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
G1FC01_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A0G2UY10_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A1J0MS84_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QUJ3_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggat-----
H0PPE7_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggat-----
T1UKP8_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggat-----
T1UHQ8_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
Q4KSL0_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
T1UHG3_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A384ZUF2_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
M0QUN2_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
E1CIM6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
E1AI10_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
Q9YL99_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
K7ZLN6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
E1CIR1_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A1Y1BXT7_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A8F5PHF8_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
T1UHH6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
M0QVT4_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
T1ULJ8_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
E9P585_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
D4N3H6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
C4P207_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
T1ULP4_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A384ZUM9_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
B9A5Q1_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
M0QUB4_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
M0QVK6_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A3G8WIY5_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
X4Y9D2_E1B19K-01        tggttgacaaatggcgccaggacaccca---actgagcaggggct-----
T1UHL7_E1B19K-01        tggttgacaaatggagccaggacaccca---actgagcaggggct-----
A0A075TSZ1_E1B19K-      tggttgacaaatggagccaggacaccca---actgagcaggggct-----
F1DT57_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A3Q9FFS0_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QUF3_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
E5RWD9_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
E5RWL1_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
B6DU90_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
B9A5T7_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A7R6T9I9_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
B6C6W8_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
B9A681_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A1Y1BYF1_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
T1UHZ2_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
B2VQE3_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QU76_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QVC7_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
M0QU41_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A097I4T0_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
A0A3S6PYX7_E1B19K-      tggttgacaaatggagccagaacaccca---actgagcaggggct-----
C5HDR2_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
D3GBW3_E1B19K-01        tggttgacaaatggagccagaacaccca---actgagcaggggct-----
T1UK99_E1B19K-01        tggttgacaaatggagccagcaaaccca---cttaaccagggatt-----
G1FBW4_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
T1UKQ0_E1B19K-01        tggttgacaaatggagccagcaaaccca---cttaaccagggatt-----
M0QVP5_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
H5T740_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
M0QUW8_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
E1CIJ0_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
T1UGU0_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
M0QV47_E1B19K-01        tggttgacaaatggagccagcaaaccca---cctaaccagggatt-----
T1UGY3_E1B19K-02        ----------atggagccaggacaccca---actaagcaggggct-----
A0A1P8C849_E1B19K-      ----------atggagccaggacaccca---actaagcaggggct-----
A0A1P7YYY5_E1B19K-      ----------atggagccaggacaccca---actaagcaggggct-----
T1UG22_E1B19K-02        ----------atggagccaggacaccca---actaagcaggggct-----
A0A1P7YWR9_E1B19K-      ----------atggagccaggacaccca---actaagcaggggct-----
A0A1P7YXN8_E1B19K-      ----------atggagccaggacaccca---actaagcaggggct-----
A0A1P7YWY2_E1B19K-      ----------atggagccaggacaccca---actaagcaggggct-----
M0QU02_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
M0QUS9_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
M0QV47_E1B19K-02        ----------atggagccagcaaaccca---cctaaccagggatt-----
T1UGU0_E1B19K-02        ----------atggagccagcaaaccca---cctaaccagggatt-----
M0QUW8_E1B19K-02        ----------atggagccagcaaaccca---cctaaccagggatt-----
M0QVP5_E1B19K-02        ----------atggagccagcaaaccca---cctaaccagggatt-----
G1FBW4_E1B19K-02        ----------atggagccagcaaaccca---cctaaccagggatt-----
T1UKQ0_E1B19K-02        ----------atggagccagcaaaccca---cttaaccagggatt-----
F8UFP5_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
T1UGT5_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
A0A384ZUM9_E1B19K-      ----------atggagccaggacaccca---actgagcaggggct-----
M0QV87_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
T1UKV6_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
A0A3S6PYX7_E1B19K-      ----------atggagccagaacaccca---actgagcaggggct-----
C5HDR2_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
A0A097I4T0_E1B19K-      ----------atggagccagaacaccca---actgagcaggggct-----
T1UHZ2_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
A0A3Q9FFS0_E1B19K-      ----------atggagccagaacaccca---actgagcaggggct-----
M0QVC7_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QU76_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QU41_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QUJ3_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggat-----
M0QUF3_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QTS5_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QV08_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
T1UGX3_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
G1FC01_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
G3CK71_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
A0A0G2UY10_E1B19K-      ----------atggagccagaacaccca---actgagcaggggct-----
T1ULP4_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
F1DT57_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
T1UHQ8_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
T1UHL7_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
A0A075TSZ1_E1B19K-      ----------atggagccaggacaccca---actgagcaggggct-----
C4P207_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
A0A8F5PHF8_E1B19K-      ----------atggagccaggacaccca---actgagcaggggct-----
T1UHG3_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
A0A384ZUF2_E1B19K-      ----------atggagccaggacaccca---actgagcaggggct-----
M0QUN2_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
E1AI10_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
M0QVK6_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
T1UHH6_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
T1UK99_E1B19K-02        ----------atggagccagcaaaccca---cttaaccagggatt-----
M0QVG6_E1B19K-02        ----------atggagccagcaaaccca---tctgaccagggatt-----
T1UKP8_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggat-----
W8CZB0_E1B19K-02        ----------atggagccagaacaccca---actgagcaggggct-----
M0QUB4_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
M0QVT4_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
E9P585_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
T1ULJ8_E1B19K-02        ----------atggagccaggacaccca---actgagcaggggct-----
A0A7L4WIC2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcgggggat-----
Q6WQ37_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
Q6VGV8_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A0G2R248_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7D0TN91_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A5K6WAR5_E1B19K-      taaaggataaatggagcgaagaaaccca---tttgagcggggggt-----
A0A3S9SND6_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3S9SNH4_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A513TZR1_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7L4WK62_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A291P1B2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
T1UG63_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HJZ5_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A8F9W8V2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3S9SP19_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A6M4W5T4_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7L4WG90_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A516UYM9_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
J9Z4H6_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A1U9ALK7_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A6M5E4Y6_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
P03247_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3G8W3H5_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
E1U5L6_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A516UYI9_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HJ54_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
J9Z5H0_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7L4WJT1_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7L4WIG2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3S9SPV1_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HK78_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HK00_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HJ63_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7D6TSN5_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A4P2SGW2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A2H4PJ75_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7L4WGT1_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
J7I6T8_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
Q71BY5_E1B19K-04        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3S9SSS2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
E1ARN8_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
J9Z4N4_E1B19K-01        taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3Q9HLF7_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A3S9SNY0_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
A0A7D0TLU2_E1B19K-      taaaggataaatggagcgaagaaaccca---tctgagcggggggt-----
J9Z4N4_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1ARN8_E1B19K-03        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1ARN8_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1ARN8_E1B19K-04        ----------atggagcgaagaaaccca---tctgagcggggggt-----
J9Z4H6_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
Q6VGV8_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
A0A0G2R248_E1B19K-      ----------atggagcgaagaaaccca---tctgagcggggggt-----
A0A4P2SGW2_E1B19K-      ----------atggagcgaagaaaccca---tctgagcggggggt-----
J7I6T8_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
T1UG63_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1U5L6_E1B19K-03        ----------atggagcgaagaaaccca---tctgagcggggggt-----
J9Z5H0_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1U5L6_E1B19K-02        ----------atggagcgaagaaaccca---tctgagcggggggt-----
E1U5L6_E1B19K-04        ----------atggagcgaagaaaccca---tctgagcggggggt-----
D3JIR7_E1B19K-02        ----------atggagccagacgtccca---gctgagttgggatt-----
D3JIR7_E1B19K-01        ----------atggagttggaag---------ctgtgctgcaa-------
A0A076V686_E1B19K-      ----------atggagttggaag---------ctgtgctgcaa-------
A0A5H2QAX5_E1B19K-      ----------atggagcgagaggtccca---cctgagctgggatt-----
T1UEX7_E1B19K-02        ----------atggagcgagaggtccca---cctgagctgggatt-----
P04492_E1B19K-02        ----------atggagcgagaaatccca---cctgagttgggatt-----
G1DE13_E1B19K-01        ----------atggagctagaag---------ctgtgttgcaa-------
A0A5H2QAX5_E1B19K-      ----------atggagctagaag---------ctgtgttgcaa-------
D0Z5R9_E1B19K-01        ----------atggagctagaag---------ctgtgttgcaa-------
T1UEX7_E1B19K-01        ----------atggagctagaag---------ctgtgttgcaa-------
A0A3G8WH01_E1B19K-      ----------atggagttggaaa---------ctgtgctgcaa-------
P04492_E1B19K-01        ----------atggagttggaaa---------ctgtgctgcaa-------

Q7T8D8_E1B19K-03        gaatgttatgggatctactgtggatggaagacccgtccaacccgccaatt
Q6RK98_E1B19K-03        gaatgtcatgggatccactgtggatgggagacccgtccagcccgccaatt
A0A097IW62_E1B19K-      --acactttggattacat----tactcttcagttatggaaggcttacatg
A0A0M3TH18_E1B19K-      --atactttagattacat----tagtttgcagctatggaaggcttacatg
A0A1W5PVU4_E1B19K-      --atactttagattacat----tagtttgcagctatggaaggcttacatg
A0A2H4CJZ0_E1B19K-      --acaccctggactacct----gaccatgtccctgtggagggccatgctg
H8PFZ1_E1B19K-01        --acaccctggactacct----gaccatgtccctgtggagggccatgctg
G0ZAH2_E1B19K-01        --accgcctcgattgctt----ggccctcgcgatatggaagcacacgctg
F6KST6_E1B19K-01        --acacgctggacttcct----aacgctatgcctgtggaagtttggcatc
Q695T5_E1B19K-02        --atactctggacttcct----gacgctatgcctatggaagttcggaatc
F2WTG5_E1B19K-01        --acactctggacttcct----gacgctatgcctatggaagttcgggatc
Q695T5_E1B19K-01        --atactctggacttcct----gacgctatgcctatggaagttcggaatc
H9TER0_E1B19K-01        --acactctggacttcct----gacgctatgcctatggaagttcggaatc
A0A1L3INW0_E1B19K-      --acaccctggatttttt----gacgctgagcctgtggaagacagggctg
P10543_E1B19K-01        --------tgagttaca---------------------------------
A0A6M6AEV2_E1B19K-      --------tgagttaca---------------------------------
A0A142G3J2_E1B19K-      --------tgagttaca---------------------------------
A0A7U3RVU4_E1B19K-      --------tgagttaca---------------------------------
A0A482EVC6_E1B19K-      --atactctggattacat----gacaatggccctgtggagaaccctgctg
A0A7U3RWV6_E1B19K-      --------tgagctaca---------------------------------
A0A1S6ELT2_E1B19K-      --------tgagctaca---------------------------------
A0A3G4W995_E1B19K-      --------tgagctgca---------------------------------
A0A898KBW7_E1B19K-      --------tgagctaca---------------------------------
A0A3G8W407_E1B19K-      --------tgagctaca---------------------------------
F4ZCJ8_E1B19K-01        --------tgagctaca---------------------------------
A0A6B9DS29_E1B19K-      --------tgagctaca---------------------------------
A0A8G1GLF6_E1B19K-      --------tgagctaca---------------------------------
B5SNR1_E1B19K-01        --------tgagctaca---------------------------------
P10544_E1B19K-01        --------tgagctaca---------------------------------
A0A482EVC6_E1B19K-      --------tgagctaca---------------------------------
A0A898KBR0_E1B19K-      --------tgagctaca---------------------------------
A0A898KBS1_E1B19K-      --------tgagctaca---------------------------------
W0S1G8_E1B19K-01        --------tgagctaca---------------------------------
A0A6M6AES6_E1B19K-      --------tgagctaca---------------------------------
A0A2H5AI99_E1B19K-      --------------------------atggatctgttgaaagagctg---
A0MK43_E1B19K-02        --acatgctggattacat----ggcgatggctctgtggagggccatgct-
A0A0A1EUE4_E1B19K-      ------------------------tgatggatctgttggggaacttg---
A0MK43_E1B19K-01        --------------------------atggatctcttggggaacttg---
A0A2H5AID8_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIL0_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIC5_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AI40_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AII9_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIN5_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIU0_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIS9_E1B19K-      ------------------------taatggatctcttggggaacttg---
A0A2H5AIT6_E1B19K-      ------------------------taatggatctcttggggaacttg---
Q5C8R2_E1B19K-01        --------------------------atggatctgctaggagaccta---
A0A2H5AI21_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A0M5L3Y4_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A0A1EUC8_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A2H5AI04_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A2H5AI72_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A2H5AIL3_E1B19K-      --------------------------atggatctgctaggagacctg---
A0A0A1EUB2_E1B19K-      --------------------------atggatctgctaggagaccta---
A0A0M4NHE0_E1B19K-      --acaccctggattacat----cagcttgcagctgtggaggttttggct-
H9AAD9_E1B19K-01        --acaccctggattacat----cagcttgcagctgtggaggttttggct-
H9AAK5_E1B19K-01        --acaccctggattacat----cagcttgcagctgtggaggttttggct-
H9AAH3_E1B19K-01        --acaccctggattacat----cagcttgcagctgtggaggttttggct-
F2WTJ7_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
F2WTM9_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
A0A1C8EG46_E1B19K-      --acaccctggattacat----cagcttgcagctgtggaggttctggct-
H9AAA8_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
H9AA76_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
H9AAN8_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
H9AAS0_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
H9AAV3_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
H9AAY5_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
M9YVA3_E1B19K-01        --acaccctggattacat----cagcctgcagctgtggaggttctggct-
Q6QPF3_E1B19K-01        ----gatctggact--------------------------gtcttggaag
Q6QPB7_E1B19K-01        ----gatctggacg--------------------------gtcttggaag
Q6QPI9_E1B19K-01        ----gatctggaca--------------------------gtcttggaag
G9G841_E1B19K-01        ----gatttggacg--------------------------atcttggaag
Q8UY91_E1B19K-01        ----gatttggacg--------------------------gtcttggaag
P10406_E1B19K-01        ----gatttggacg--------------------------gttttggaag
Q5GFC7_E1B19K-02        ----gatttggacg--------------------------gttttggaag
A0A2R3WN62_E1B19K-      ----gatttggacg--------------------------gttttggaag
A0A3G9CMQ4_E1B19K-      ----gatttggacg--------------------------gttttggaag
Q5GFC7_E1B19K-01        ----gatttggacg--------------------------gttttggaag
Q5GFC8_E1B19K-01        ----gatttggacg--------------------------gttttggaag
Q6H1D7_E1B19K-01        ----gatttggacg--------------------------gttttggaag
A0A3G9JTX5_E1B19K-      ----gatttggacg--------------------------gtcttggaag
Q2KSM8_E1B19K-02        ----gatttggacg--------------------------gtcttggaag
A0A2R3WNP3_E1B19K-      ----gatttggacg--------------------------gtcttggaag
A0A3G8W6L2_E1B19K-      ----gatttggacg--------------------------gtcttggaag
A0A3G9K5X3_E1B19K-      ----gatttggacg--------------------------gtcttggaag
Q2KSG6_E1B19K-01        ----gatttggacg--------------------------gtcttggaag
Q2KSM8_E1B19K-01        ----gatttggacg--------------------------gtcttggaag
A0A2R3WN16_E1B19K-      ----gatttggacg--------------------------gtcttggaag
Q2KSG6_E1B19K-02        ----gatttggacg--------------------------gtcttggaag
A0A2L1F392_E1B19K-      ----gatttggacg--------------------------gtcttggaag
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
Q7T951_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
T1UE63_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
Q7T8D8_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
Q5UW22_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
Q8B8U7_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
Q32UI6_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
A0A7G5FB98_E1B19K-      ----ggtttgggcc--------------------------attttggaag
A0A7G5F9T0_E1B19K-      ----ggtttgggcc--------------------------attttggaag
J7H4R9_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
D2DM83_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
J7I6W7_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
C7SRS7_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
A0A7U3S1T6_E1B19K-      ----ggtttgggcc--------------------------attttggaag
A0A7U3S224_E1B19K-      ----ggtttgggcc--------------------------attttggaag
W6EIX6_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
A0A1L7NRH1_E1B19K-      ----ggtttgggcc--------------------------attttggaag
Q3ZL02_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
T1UFS4_E1B19K-01        ----ggtttgggcc--------------------------attttggaag
T2CI10_E1B19K-01        ----ggtttgggcc--------------------------atcttggaag
A0A0K0PX35_E1B19K-      ----ggtttgggct--------------------------atcttggaag
A0A0K0PX99_E1B19K-      ----ggtttgggct--------------------------atcttggaag
Q3ZKW2_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q2KRU2_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
K7NG43_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q2KS85_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A0B4SJH1_E1B19K-      ----ggtttgggct--------------------------atcttggaag
A0A075IQ70_E1B19K-      ----ggtttgggct--------------------------atcttggaag
T1UIP3_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
R4HLE1_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q5EY83_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q2Y0J3_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
R4HMC6_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A897JQR0_E1B19K-      ----ggtttgggct--------------------------atcttggaag
I1V161_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A5P8KYF0_E1B19K-      ----ggtttgggct--------------------------atcttggaag
J7I6S4_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A220VZ73_E1B19K-      ----ggtttgggct--------------------------atcttggaag
P03248_E1B19K-02        ----ggtttgggct--------------------------atcttggaag
Q6RK98_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
J7I6Q4_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A8B0LCV0_E1B19K-      ----ggtttgggct--------------------------atcttggaag
J7ID56_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
I6LEP5_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A6M6AA96_E1B19K-      ----ggtttgggct--------------------------atcttggaag
A0A8B0LD36_E1B19K-      ----ggtttgggct--------------------------atcttggaag
A0A8B0LBX6_E1B19K-      ----ggtttgggct--------------------------atcttggaag
A0A8B0L9Y2_E1B19K-      ----ggtttgggct--------------------------atcttggaag
R4HLJ6_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
R4HLA0_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q2KSL3_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
A0A5J6CTQ0_E1B19K-      ----ggtttgggct--------------------------atcttggaag
I6LES1_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
T1UF50_E1B19K-01        ----ggtttgggct--------------------------atcttggaag
Q7T8D8_E1B19K-02        --acgttttggatttcat----agccacagcattgtggagaacatggaag
Q32UI6_E1B19K-02        --acgttttggatttcgt----agccacagcattgtggagaacatggaag
A0A7G5FB98_E1B19K-      --acgttttggatttcgt----agccacagcattgtggagaacatggaag
J7I6W7_E1B19K-02        --acgttttggatttcgt----agccacagcattgtggagaacatggaag
W6EIX6_E1B19K-02        --acgttttggatttcat----agccacagcattgtggagaacatggaag
Q3ZL02_E1B19K-02        --acgttttggatttcgt----agccacagcattgtggagaacatggaag
T1UFS4_E1B19K-02        --acgttttggatttcgt----agccacagcattgtggagaacatggaag
T1UE63_E1B19K-02        --acgttttggatttcat----agccacagcattgtggagaacatggaag
T1UJX4_E1B19K-02        --acgttttggatttcat----agccacagcattgtggagaacatggaag
T2CI10_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q2Y0J3_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q5EY83_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
J7ID56_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
I6LEP5_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q2KSL3_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
T1UF50_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
R4HLE1_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
P03248_E1B19K-03        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q6RK98_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
J7I6Q4_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
R4HMC6_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
I1V161_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
A0A5P8KYF0_E1B19K-      --acgttttggatttcat----agcagcagctttgtggagaacatggaag
J7I6S4_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
A0A897JQR0_E1B19K-      --acgttttggatttcat----agcagcagctttgtggagaacatggaag
K7NG43_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q3ZKW2_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q2KRU2_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
T1UIP3_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
Q2KS85_E1B19K-02        --acgttttggatttcat----agcagcagctttgtggagaacatggaag
A0A0B4SJH1_E1B19K-      --acgttttggatttcat----agcagcagctttgtggagaacatggaag
A0A075IQ70_E1B19K-      --acgttttggatttcat----agcagcagctttgtggagaacatggaag
M9YVF6_E1B19K-01        --acatgctggattacat----gaccatggcgttgtggcgggcgctcctg
A0A0M3TH31_E1B19K-      --acatgctggattacat----gaccatggcgctgtggcgggcgctcctg
M9YXY5_E1B19K-01        --acatgctggattacat----gaccatggcgctgtggcgggcgctcctg
Q71BY5_E1B19K-01        --ggccgccagtcttttg----gaccagctaatcgaagaggtactggct-
Q71BY5_E1B19K-02        --ggccgccagtcttttg----gaccagctaatcgaagaggtactggct-
Q71BY5_E1B19K-03        --ggccgccagtcttttg----gaccagctaatcgaagag----------
P06501_E1B19K-01        --accagatggattacat----cagcctgaacctgtggaagttttggtt-
A0A0M4N3Z1_E1B19K-      --accagatggattacat----cagcctgaacctgtggaagttttggtt-
Q8B6X5_E1B19K-01        --accagatggattacat----caggctgaacctgtggaagttttggtt-
B9A5L5_E1B19K-01        --acattctggactttgc----agccatgcacctgtggagggcctggatg
T1UGY3_E1B19K-01        --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YYY5_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YWY2_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YWR9_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YXN8_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P8C849_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
B9A5A7_E1B19K-01        --acattctggactttgc----agccatgcacctgtggagggcctggatg
T1UG22_E1B19K-01        --acattctggactttgc----agccatgcacctgtggagggcctggatg
M0QVG6_E1B19K-01        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
X4YVU5_E1B19K-01        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
M0QUS9_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggagggcctgggtc
M0QU02_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A291B0H2_E1B19K-      --acatcctggacttcgc----agccatgcatctgtggagggcctggatc
M0QV87_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UKV6_E1B19K-01        --acatcctggacttcgc----agccatgcatctgtggagggcctggatc
W8VNG2_E1B19K-01        --acatcctggacttcgc----ggccatgcacctgtggagggcctggatc
F8UFP5_E1B19K-01        --acatcctggacttcgc----ggccatgcacctgtggagggcctggatc
T1UGT5_E1B19K-01        --acatcctggacttcgc----ggccatgcacctgtggagggcctgggtc
T1UGX3_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcctgggtc
W8CZB0_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcctgggtc
G3CK71_E1B19K-01        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
M0QTS5_E1B19K-01        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
M0QV08_E1B19K-01        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
G9JUV5_E1B19K-01        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
G1FC01_E1B19K-01        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
A0A0G2UY10_E1B19K-      --acattctggacttcgc----ggccatgcacctgtggaggtcctggatc
A0A1J0MS84_E1B19K-      --acatcctggacttcgc----ggccatgcacctgtggaggtcctgggtc
M0QUJ3_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
H0PPE7_E1B19K-01        --acatcctggacttcgc----ggccatgcacctgtggagggcctggatc
T1UKP8_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
T1UHQ8_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
Q4KSL0_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UHG3_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A384ZUF2_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QUN2_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E1CIM6_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E1AI10_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
Q9YL99_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
K7ZLN6_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E1CIR1_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A1Y1BXT7_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A8F5PHF8_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UHH6_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
M0QVT4_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1ULJ8_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E9P585_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
D4N3H6_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
C4P207_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1ULP4_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A384ZUM9_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
B9A5Q1_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QUB4_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QVK6_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A3G8WIY5_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
X4Y9D2_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
T1UHL7_E1B19K-01        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
A0A075TSZ1_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
F1DT57_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
A0A3Q9FFS0_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcatgggtg
M0QUF3_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
E5RWD9_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
E5RWL1_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
B6DU90_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
B9A5T7_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
A0A7R6T9I9_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
B6C6W8_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
B9A681_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
A0A1Y1BYF1_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
T1UHZ2_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
B2VQE3_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QU76_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QVC7_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QU41_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
A0A097I4T0_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
A0A3S6PYX7_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
C5HDR2_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
D3GBW3_E1B19K-01        --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
T1UK99_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
G1FBW4_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
T1UKQ0_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
M0QVP5_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
H5T740_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
M0QUW8_E1B19K-01        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
E1CIJ0_E1B19K-01        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
T1UGU0_E1B19K-01        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
M0QV47_E1B19K-01        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
T1UGY3_E1B19K-02        --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P8C849_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YYY5_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
T1UG22_E1B19K-02        --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YWR9_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YXN8_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
A0A1P7YWY2_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcctggatg
M0QU02_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QUS9_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggagggcctgggtc
M0QV47_E1B19K-02        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
T1UGU0_E1B19K-02        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
M0QUW8_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
M0QVP5_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
G1FBW4_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
T1UKQ0_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
F8UFP5_E1B19K-02        --acatcctggacttcgc----ggccatgcacctgtggagggcctggatc
T1UGT5_E1B19K-02        --acatcctggacttcgc----ggccatgcacctgtggagggcctgggtc
A0A384ZUM9_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QV87_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UKV6_E1B19K-02        --acatcctggacttcgc----agccatgcatctgtggagggcctggatc
A0A3S6PYX7_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
C5HDR2_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
A0A097I4T0_E1B19K-      --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
T1UHZ2_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
A0A3Q9FFS0_E1B19K-      --acattctggactttgc----agccatgcacctgtggagggcatgggtg
M0QVC7_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QU76_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QU41_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QUJ3_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QUF3_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtg
M0QTS5_E1B19K-02        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
M0QV08_E1B19K-02        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
T1UGX3_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcctgggtc
G1FC01_E1B19K-02        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
G3CK71_E1B19K-02        --acattctggacttcgc----ggccatgcacctgtggagggcctgggtc
A0A0G2UY10_E1B19K-      --acattctggacttcgc----ggccatgcacctgtggaggtcctggatc
T1ULP4_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
F1DT57_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcatgggtc
T1UHQ8_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UHL7_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
A0A075TSZ1_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
C4P207_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A8F5PHF8_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UHG3_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A384ZUF2_E1B19K-      --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QUN2_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E1AI10_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QVK6_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1UHH6_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
T1UK99_E1B19K-02        --acatcctggacttcac----ggccatgcacctgtggaaggcctgggtc
M0QVG6_E1B19K-02        --acatcctggacttcac----ggccatgcatctgtggaaggcctgggtc
T1UKP8_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggaggtcctggatc
W8CZB0_E1B19K-02        --acattctggacttcgc----agccatgcacctgtggagggcctgggtc
M0QUB4_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
M0QVT4_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
E9P585_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
T1ULJ8_E1B19K-02        --acatcctggacttcgc----agccatgcacctgtggagggcctggatc
A0A7L4WIC2_E1B19K-      --acctgctggattttct----agccatgcatctgtggagagcggtggt-
Q6WQ37_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggttgt-
Q6VGV8_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggttgt-
A0A0G2R248_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggttgt-
A0A7D0TN91_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A5K6WAR5_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3S9SND6_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3S9SNH4_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A513TZR1_E1B19K-      --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
A0A7L4WK62_E1B19K-      --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
A0A291P1B2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
T1UG63_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3Q9HJZ5_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A8F9W8V2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3S9SP19_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A6M4W5T4_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A7L4WG90_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A516UYM9_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J9Z4H6_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A1U9ALK7_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A6M5E4Y6_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
P03247_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3G8W3H5_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
E1U5L6_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A516UYI9_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3Q9HJ54_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J9Z5H0_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A7L4WJT1_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A7L4WIG2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3S9SPV1_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3Q9HK78_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3Q9HK00_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A3Q9HJ63_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A7D6TSN5_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A4P2SGW2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A2H4PJ75_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
A0A7L4WGT1_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J7I6T8_E1B19K-01        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
Q71BY5_E1B19K-04        --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
A0A3S9SSS2_E1B19K-      --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
E1ARN8_E1B19K-01        --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
J9Z4N4_E1B19K-01        --acctgctggattttct----ggccatgcatttgtggagagcagtggt-
A0A3Q9HLF7_E1B19K-      --acctgctggattttct----ggccatgcatttgtggagagcagtggt-
A0A3S9SNY0_E1B19K-      --acctgctggattttct----ggccatgcatttgtggagagcagtggt-
A0A7D0TLU2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J9Z4N4_E1B19K-02        --acctgctggattttct----ggccatgcatttgtggagagcagtggt-
E1ARN8_E1B19K-03        --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
E1ARN8_E1B19K-02        --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
E1ARN8_E1B19K-04        --acctgctggattttct----ggccatgcatttgtggagagcggtggt-
J9Z4H6_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
Q6VGV8_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggttgt-
A0A0G2R248_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggttgt-
A0A4P2SGW2_E1B19K-      --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J7I6T8_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
T1UG63_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
E1U5L6_E1B19K-03        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
J9Z5H0_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
E1U5L6_E1B19K-02        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
E1U5L6_E1B19K-04        --acctgctggattttct----ggccatgcatctgtggagagcggtggt-
D3JIR7_E1B19K-02        --acatgctggattacat----ggcaatgcagctgtggagggcatggct-
D3JIR7_E1B19K-01        ---------agttatca---------------------------------
A0A076V686_E1B19K-      ---------agttatca---------------------------------
A0A5H2QAX5_E1B19K-      --acatgctggattacat----gacaatgcatttgtggagggcatggct-
T1UEX7_E1B19K-02        --acatgctggattacat----ggcaatgcatttgtggagggcatggct-
P04492_E1B19K-02        --acatgctggattacat----gtcaatgcagctgtggagggcatggct-
G1DE13_E1B19K-01        ---------agttttca---------------------------------
A0A5H2QAX5_E1B19K-      ---------agttttca---------------------------------
D0Z5R9_E1B19K-01        ---------agttttca---------------------------------
T1UEX7_E1B19K-01        ---------agttttca---------------------------------
A0A3G8WH01_E1B19K-      ---------agttttca---------------------------------
P04492_E1B19K-01        ---------agttttca---------------------------------

Q7T8D8_E1B19K-03        cttcaacgctgacctatgctactttaagttcttcacctttggacgcagct
Q6RK98_E1B19K-03        cctcaacgctgacctatgccactttgagttcgtcaccattggatgcagct
A0A097IW62_E1B19K-      aggaaggg---------------gaagatttacaccttctcgcgggagcc
A0A0M3TH18_E1B19K-      aggaaggg---------------gaagatctacaccttctcgcaggggcc
A0A1W5PVU4_E1B19K-      aggaaggg---------------gaagatctacacattctcgcaggggcc
A0A2H4CJZ0_E1B19K-      aggaagag---------------gagggtctcaggcttctcgccggcgcg
H8PFZ1_E1B19K-01        cggaagag---------------gagggtctcaggcttctcgccggcgcg
G0ZAH2_E1B19K-01        aggga------------------ggggatcctgagaggggtgatgcaggg
F6KST6_E1B19K-01        aggaaggggcg------------gaagctttacaggcgtttggtggagag
Q695T5_E1B19K-02        aggagggggag------------gaagctgtacgggcgcttggtggagag
F2WTG5_E1B19K-01        aggagagggag------------gaagctgtacgggcgcctggtggagag
Q695T5_E1B19K-01        aggagggggag------------gaagctgtacgggcgcttggtggagag
H9TER0_E1B19K-01        aggagggggag------------gaagctgtacgggcgcttggtggagag
A0A1L3INW0_E1B19K-      aagaggggcaggaagctttacgggagaatgttagagcgccatccttcgct
P10543_E1B19K-01        ------------------------aagttatcag---------------a
A0A6M6AEV2_E1B19K-      ------------------------aagttatcag---------------a
A0A142G3J2_E1B19K-      ------------------------aagttatcaa---------------a
A0A7U3RVU4_E1B19K-      ------------------------aagttatgaa---------------a
A0A482EVC6_E1B19K-      cg------gaggaa---------gagggtcttaggttgctcgccggcgca
A0A7U3RWV6_E1B19K-      ------------------------aagttatcag---------------a
A0A1S6ELT2_E1B19K-      ------------------------aagttatcag---------------a
A0A3G4W995_E1B19K-      ------------------------aagttatcag---------------a
A0A898KBW7_E1B19K-      ------------------------aagttatcag---------------a
A0A3G8W407_E1B19K-      ------------------------aagttatcag---------------a
F4ZCJ8_E1B19K-01        ------------------------aagttatcag---------------a
A0A6B9DS29_E1B19K-      ------------------------aagttatcag---------------a
A0A8G1GLF6_E1B19K-      ------------------------aagttatcag---------------a
B5SNR1_E1B19K-01        ------------------------aagttatcag---------------a
P10544_E1B19K-01        ------------------------aagttatcag---------------a
A0A482EVC6_E1B19K-      ------------------------aagttatcag---------------a
A0A898KBR0_E1B19K-      ------------------------aagttatcag---------------a
A0A898KBS1_E1B19K-      ------------------------aagttatcag---------------a
W0S1G8_E1B19K-01        ------------------------aagttatcag---------------a
A0A6M6AES6_E1B19K-      ------------------------aagttatcag---------------a
A0A2H5AI99_E1B19K-      -------------a---------gggatttt-------------gacgtt
A0MK43_E1B19K-02        --------gcggag---------gagggtttgcatttacttgcgggcgca
A0A0A1EUE4_E1B19K-      -------------c---------gggaattt-------------gacgtg
A0MK43_E1B19K-01        -------------a---------gggaattt-------------gacgtg
A0A2H5AID8_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIL0_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIC5_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AI40_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AII9_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIN5_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIU0_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIS9_E1B19K-      -------------a---------gggaattt-------------gacgtg
A0A2H5AIT6_E1B19K-      -------------a---------gggaattt-------------gacgtg
Q5C8R2_E1B19K-01        -------------a---------gagaattt-------------ggcgtg
A0A2H5AI21_E1B19K-      -------------a---------gagaattt-------------ggcgtg
A0A0M5L3Y4_E1B19K-      -------------a---------gagaattt-------------ggcgtg
A0A0A1EUC8_E1B19K-      -------------a---------gggaattt-------------ggcgtg
A0A2H5AI04_E1B19K-      -------------a---------gggaattt-------------ggcgtg
A0A2H5AI72_E1B19K-      -------------a---------gggaattt-------------ggcgtg
A0A2H5AIL3_E1B19K-      -------------a---------gggaattt-------------ggcgtg
A0A0A1EUB2_E1B19K-      -------------a---------gagaattt-------------ggcgtg
A0A0M4NHE0_E1B19K-      --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAD9_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAK5_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAH3_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
F2WTJ7_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
F2WTM9_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
A0A1C8EG46_E1B19K-      --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAA8_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AA76_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAN8_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAS0_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAV3_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
H9AAY5_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
M9YVA3_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
Q6QPF3_E1B19K-01        actttcacca----------------------------------------
Q6QPB7_E1B19K-01        actttcacca----------------------------------------
Q6QPI9_E1B19K-01        actttcacca----------------------------------------
G9G841_E1B19K-01        atcttcacaa----------------------------------------
Q8UY91_E1B19K-01        actttcacaa----------------------------------------
P10406_E1B19K-01        actttcacaa----------------------------------------
Q5GFC7_E1B19K-02        actttcacaa----------------------------------------
A0A2R3WN62_E1B19K-      actttcacaa----------------------------------------
A0A3G9CMQ4_E1B19K-      actttcacaa----------------------------------------
Q5GFC7_E1B19K-01        actttcacaa----------------------------------------
Q5GFC8_E1B19K-01        actttcacaa----------------------------------------
Q6H1D7_E1B19K-01        actttcacaa----------------------------------------
A0A3G9JTX5_E1B19K-      acttttacaa----------------------------------------
Q2KSM8_E1B19K-02        acttttacaa----------------------------------------
A0A2R3WNP3_E1B19K-      acttttacaa----------------------------------------
A0A3G8W6L2_E1B19K-      acttttacaa----------------------------------------
A0A3G9K5X3_E1B19K-      acttttacaa----------------------------------------
Q2KSG6_E1B19K-01        acttttacaa----------------------------------------
Q2KSM8_E1B19K-01        acttttacaa----------------------------------------
A0A2R3WN16_E1B19K-      acttttacaa----------------------------------------
Q2KSG6_E1B19K-02        acttttacaa----------------------------------------
A0A2L1F392_E1B19K-      acttttacaa----------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ac------------------------------------------------
Q7T951_E1B19K-01        ac------------------------------------------------
T1UE63_E1B19K-01        ac------------------------------------------------
Q7T8D8_E1B19K-01        ac------------------------------------------------
Q5UW22_E1B19K-01        ac------------------------------------------------
Q8B8U7_E1B19K-01        ac------------------------------------------------
Q32UI6_E1B19K-01        ac------------------------------------------------
A0A7G5FB98_E1B19K-      ac------------------------------------------------
A0A7G5F9T0_E1B19K-      ac------------------------------------------------
J7H4R9_E1B19K-01        ac------------------------------------------------
D2DM83_E1B19K-01        ac------------------------------------------------
J7I6W7_E1B19K-01        ac------------------------------------------------
C7SRS7_E1B19K-01        ac------------------------------------------------
A0A7U3S1T6_E1B19K-      ac------------------------------------------------
A0A7U3S224_E1B19K-      ac------------------------------------------------
W6EIX6_E1B19K-01        ac------------------------------------------------
A0A1L7NRH1_E1B19K-      ac------------------------------------------------
Q3ZL02_E1B19K-01        ac------------------------------------------------
T1UFS4_E1B19K-01        ac------------------------------------------------
T2CI10_E1B19K-01        at------------------------------------------------
A0A0K0PX35_E1B19K-      ac------------------------------------------------
A0A0K0PX99_E1B19K-      ac------------------------------------------------
Q3ZKW2_E1B19K-01        ac------------------------------------------------
Q2KRU2_E1B19K-01        ac------------------------------------------------
K7NG43_E1B19K-01        ac------------------------------------------------
Q2KS85_E1B19K-01        ac------------------------------------------------
A0A0B4SJH1_E1B19K-      ac------------------------------------------------
A0A075IQ70_E1B19K-      ac------------------------------------------------
T1UIP3_E1B19K-01        ac------------------------------------------------
R4HLE1_E1B19K-01        ac------------------------------------------------
Q5EY83_E1B19K-01        ac------------------------------------------------
Q2Y0J3_E1B19K-01        ac------------------------------------------------
R4HMC6_E1B19K-01        ac------------------------------------------------
A0A897JQR0_E1B19K-      ac------------------------------------------------
I1V161_E1B19K-01        ac------------------------------------------------
A0A5P8KYF0_E1B19K-      ac------------------------------------------------
J7I6S4_E1B19K-01        ac------------------------------------------------
A0A220VZ73_E1B19K-      ac------------------------------------------------
P03248_E1B19K-02        ac------------------------------------------------
Q6RK98_E1B19K-01        ac------------------------------------------------
J7I6Q4_E1B19K-01        ac------------------------------------------------
A0A8B0LCV0_E1B19K-      ac------------------------------------------------
J7ID56_E1B19K-01        ac------------------------------------------------
I6LEP5_E1B19K-01        ac------------------------------------------------
A0A6M6AA96_E1B19K-      ac------------------------------------------------
A0A8B0LD36_E1B19K-      ac------------------------------------------------
A0A8B0LBX6_E1B19K-      ac------------------------------------------------
A0A8B0L9Y2_E1B19K-      ac------------------------------------------------
R4HLJ6_E1B19K-01        ac------------------------------------------------
R4HLA0_E1B19K-01        ac------------------------------------------------
Q2KSL3_E1B19K-01        ac------------------------------------------------
A0A5J6CTQ0_E1B19K-      ac------------------------------------------------
I6LES1_E1B19K-01        ac------------------------------------------------
T1UF50_E1B19K-01        ac------------------------------------------------
Q7T8D8_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
Q32UI6_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
A0A7G5FB98_E1B19K-      gttcgcaagatgag---------gacaatcttaggttactggccagtgca
J7I6W7_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
W6EIX6_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
Q3ZL02_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
T1UFS4_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
T1UE63_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
T1UJX4_E1B19K-02        gttcgcaagatgag---------gacaatcttaggttactggccagtgca
T2CI10_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtaca
Q2Y0J3_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q5EY83_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
J7ID56_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
I6LEP5_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q2KSL3_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
T1UF50_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
R4HLE1_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
P03248_E1B19K-03        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q6RK98_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
J7I6Q4_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
R4HMC6_E1B19K-02        gctcgcaggatgag---------gacaatcttaaattactggccagtgca
I1V161_E1B19K-02        gctcgcaggatgag---------gacaatcttaaattactggccagtgca
A0A5P8KYF0_E1B19K-      gctcgcaggatgag---------gacaatcttaaattactggccagtgca
J7I6S4_E1B19K-02        gctcgcaggatgag---------gacaatcttaaattactggccagtgca
A0A897JQR0_E1B19K-      gctcgcaggatgag---------gacaatcttaaattactggccagtgca
K7NG43_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q3ZKW2_E1B19K-02        gctcgcagcatgag---------gacaatcttagattactggccagtgca
Q2KRU2_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
T1UIP3_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
Q2KS85_E1B19K-02        gctcgcaggatgag---------gacaatcttagattactggccagtgca
A0A0B4SJH1_E1B19K-      gctcgcaggatgag---------gacaatcttagattactggccagtgca
A0A075IQ70_E1B19K-      gctcgcaggatgag---------gacaatcttagattactggccagtgca
M9YVF6_E1B19K-01        ag------gaggag---------gagggcttgcatttact------tgcc
A0A0M3TH31_E1B19K-      ag------gaggag---------gagggcttgcatttact------tgcc
M9YXY5_E1B19K-01        ag------gaggag---------gagggcttgcatttact------tgcc
Q71BY5_E1B19K-01        -----------------------gataatcttccacctcc-tagccattt
Q71BY5_E1B19K-02        -----------------------gataatcttccacctcc-tagccattt
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------gcgccg---------gcgggtttacaattactcgcgggggct
A0A0M4N3Z1_E1B19K-      --------gcgccg---------gcgggtttacaactactcgcgggggct
Q8B6X5_E1B19K-01        --------gcgccg---------gcgggtttacaactactcgcgggggct
B9A5L5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGY3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YYY5_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YWY2_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YWR9_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YXN8_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P8C849_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
B9A5A7_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UG22_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVG6_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
X4YVU5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUS9_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU02_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A291B0H2_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
M0QV87_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKV6_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
W8VNG2_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
F8UFP5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGT5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGX3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
W8CZB0_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
G3CK71_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QTS5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QV08_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
G9JUV5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
G1FC01_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A0G2UY10_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1J0MS84_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUJ3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
H0PPE7_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKP8_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHQ8_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
Q4KSL0_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
T1UHG3_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
A0A384ZUF2_E1B19K-      aggcagcggggaca---------gagaatcttgaattact------ggct
M0QUN2_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
E1CIM6_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
E1AI10_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
Q9YL99_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
K7ZLN6_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
E1CIR1_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
A0A1Y1BXT7_E1B19K-      aggcagcggggaca---------gaaaatcttgaattact------ggct
A0A8F5PHF8_E1B19K-      aggcagcggggaca---------gaaaatcttgaattact------ggct
T1UHH6_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVT4_E1B19K-01        aggcagcggggaca---------gagaatcttgaattact------ggct
T1ULJ8_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
E9P585_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
D4N3H6_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
C4P207_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1ULP4_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A384ZUM9_E1B19K-      aggcagcggggaca---------gagaatcttgagttact------ggct
B9A5Q1_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUB4_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVK6_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A3G8WIY5_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
X4Y9D2_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHL7_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A075TSZ1_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
F1DT57_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A3Q9FFS0_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUF3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
E5RWD9_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
E5RWL1_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
B6DU90_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
B9A5T7_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A7R6T9I9_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
B6C6W8_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
B9A681_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1Y1BYF1_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHZ2_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
B2VQE3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU76_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVC7_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU41_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A097I4T0_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A3S6PYX7_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
C5HDR2_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
D3GBW3_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UK99_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
G1FBW4_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKQ0_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVP5_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
H5T740_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUW8_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
E1CIJ0_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGU0_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QV47_E1B19K-01        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGY3_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P8C849_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YYY5_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
T1UG22_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YWR9_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YXN8_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
A0A1P7YWY2_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU02_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUS9_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QV47_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGU0_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUW8_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVP5_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
G1FBW4_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKQ0_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
F8UFP5_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGT5_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A384ZUM9_E1B19K-      aggcagcggggaca---------gagaatcttgagttact------ggct
M0QV87_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKV6_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A3S6PYX7_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
C5HDR2_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A097I4T0_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHZ2_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A3Q9FFS0_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVC7_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU76_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QU41_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUJ3_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUF3_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QTS5_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QV08_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UGX3_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
G1FC01_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
G3CK71_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A0G2UY10_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
T1ULP4_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
F1DT57_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHQ8_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHL7_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A075TSZ1_E1B19K-      aggcagcggggaca---------gagaatcttgaactact------ggct
C4P207_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A8F5PHF8_E1B19K-      aggcagcggggaca---------gaaaatcttgaattact------ggct
T1UHG3_E1B19K-02        aggcagcggggaca---------gagaatcttgaattact------ggct
A0A384ZUF2_E1B19K-      aggcagcggggaca---------gagaatcttgaattact------ggct
M0QUN2_E1B19K-02        aggcagcggggaca---------gagaatcttgaattact------ggct
E1AI10_E1B19K-02        aggcagcggggaca---------gagaatcttgaattact------ggct
M0QVK6_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UHH6_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UK99_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVG6_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1UKP8_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
W8CZB0_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QUB4_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
M0QVT4_E1B19K-02        aggcagcggggaca---------gagaatcttgaattact------ggct
E9P585_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
T1ULJ8_E1B19K-02        aggcagcggggaca---------gagaatcttgaactact------ggct
A0A7L4WIC2_E1B19K-      --------gagaca---------caagaatcgc------c------tgat
Q6WQ37_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
Q6VGV8_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A0G2R248_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A7D0TN91_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A5K6WAR5_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3S9SND6_E1B19K-      --------gagaca---------caagaatcgc------a------tgct
A0A3S9SNH4_E1B19K-      --------gagaca---------caagaatcgc------a------tgct
A0A513TZR1_E1B19K-      --------gagaca---------caagaatcgc------a------tgct
A0A7L4WK62_E1B19K-      --------gagaca---------caagaatcgc------a------tgct
A0A291P1B2_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
T1UG63_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HJZ5_E1B19K-      --------gagaca---------caagaatggc------c------tgct
A0A8F9W8V2_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3S9SP19_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A6M4W5T4_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A7L4WG90_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A516UYM9_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
J9Z4H6_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A1U9ALK7_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A6M5E4Y6_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
P03247_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A3G8W3H5_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
E1U5L6_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A516UYI9_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HJ54_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
J9Z5H0_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A7L4WJT1_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A7L4WIG2_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3S9SPV1_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HK78_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HK00_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HJ63_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A7D6TSN5_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A4P2SGW2_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A2H4PJ75_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A7L4WGT1_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
J7I6T8_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
Q71BY5_E1B19K-04        --------gagaca---------caagaatcgc------c------tact
A0A3S9SSS2_E1B19K-      --------gagaca---------caagaatcgc------c------tact
E1ARN8_E1B19K-01        --------gagaca---------caagaatcgc------c------tact
J9Z4N4_E1B19K-01        --------gagaca---------caagaatcgc------c------tgct
A0A3Q9HLF7_E1B19K-      --------gagaca---------caagaatcgc------t------tgct
A0A3S9SNY0_E1B19K-      --------gagaca---------caagaatcgc------t------tgct
A0A7D0TLU2_E1B19K-      --------gagaca---------caagaatcgt------c------tgct
J9Z4N4_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
E1ARN8_E1B19K-03        --------gagaca---------caagaatcgc------c------tact
E1ARN8_E1B19K-02        --------gagaca---------caagaatcgc------c------tact
E1ARN8_E1B19K-04        --------gagaca---------caagaatcgc------c------tact
J9Z4H6_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
Q6VGV8_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
A0A0G2R248_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
A0A4P2SGW2_E1B19K-      --------gagaca---------caagaatcgc------c------tgct
J7I6T8_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
T1UG63_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
E1U5L6_E1B19K-03        --------gagaca---------caagaatcgc------c------tgct
J9Z5H0_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
E1U5L6_E1B19K-02        --------gagaca---------caagaatcgc------c------tgct
E1U5L6_E1B19K-04        --------gagaca---------caagaatcgc------c------tgct
D3JIR7_E1B19K-02        --------cacgag---------gagggtttgcatttact------cgct
D3JIR7_E1B19K-01        -----------------------gggcgttcgt-----------------
A0A076V686_E1B19K-      -----------------------gagcattcgt-----------------
A0A5H2QAX5_E1B19K-      --------gaagag---------gagggtttgcatttact------cgct
T1UEX7_E1B19K-02        --------gaagag---------gagggtttgcatttact------cgct
P04492_E1B19K-02        --------gaagag---------gagggtttgcatttact------cgct
G1DE13_E1B19K-01        -----------------------gagcgttcgt-----------------
A0A5H2QAX5_E1B19K-      -----------------------gagcgttcgt-----------------
D0Z5R9_E1B19K-01        -----------------------gagcgttcgt-----------------
T1UEX7_E1B19K-01        -----------------------gagcgttcgt-----------------
A0A3G8WH01_E1B19K-      -----------------------gagcgttcgc-----------------
P04492_E1B19K-01        -----------------------gagcgttcgc-----------------

Q7T8D8_E1B19K-03        gcagctgcc--------gccgccgcttctgttgc----------------
Q6RK98_E1B19K-03        gca---gcc--------gccgccgctactgctgc----------------
A0A097IW62_E1B19K-      gcggtcgct---gcagcggttgcaaaccagcctc----------------
A0A0M3TH18_E1B19K-      gcggtcgctgccgcagcgggtg----------------------------
A0A1W5PVU4_E1B19K-      gcggtcgctgccgcagcgggtg----------------------------
A0A2H4CJZ0_E1B19K-      gcctccgca-----cgga---ctggatccggtgc----------------
H8PFZ1_E1B19K-01        gcctccgca-----cgga---ctggatccggtgc----------------
G0ZAH2_E1B19K-01        gccccgggc-----gcgggtga----------------------------
F6KST6_E1B19K-01        gcatccgtc-----tctgcgccagcaccggcttc----------------
Q695T5_E1B19K-02        gcatccgtc-----tctgcgccagcagcgtctgc----------------
F2WTG5_E1B19K-01        gcatccgtc-----tctgcgccagcagcgtctgc----------------
Q695T5_E1B19K-01        gcatccgtc-----tctgcgccagcagcgtctgc----------------
H9TER0_E1B19K-01        gcatccgtc-----tctgcgccagcagcgtctgc----------------
A0A1L3INW0_E1B19K-      gatccagaa-----gaccgtgcgagctcaggttc----------------
P10543_E1B19K-01        acctccg-a-----cgct--------------------------------
A0A6M6AEV2_E1B19K-      acctccg-a-----cgct--------------------------------
A0A142G3J2_E1B19K-      acctccg-a-----cgct--------------------------------
A0A7U3RVU4_E1B19K-      acctccg-a-----cgct--------------------------------
A0A482EVC6_E1B19K-      gcctccgca-----cggtc-------------------------------
A0A7U3RWV6_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A1S6ELT2_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A3G4W995_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A898KBW7_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A3G8W407_E1B19K-      gcctccg-a-----cgct--------------------------------
F4ZCJ8_E1B19K-01        gcctccg-a-----cgct--------------------------------
A0A6B9DS29_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A8G1GLF6_E1B19K-      gcctccg-a-----cgct--------------------------------
B5SNR1_E1B19K-01        gcctccg-a-----cgct--------------------------------
P10544_E1B19K-01        gcctccg-a-----cgct--------------------------------
A0A482EVC6_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A898KBR0_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A898KBS1_E1B19K-      gcctccg-a-----cgct--------------------------------
W0S1G8_E1B19K-01        gcctccg-a-----cgct--------------------------------
A0A6M6AES6_E1B19K-      gcctccg-a-----cgct--------------------------------
A0A2H5AI99_E1B19K-      g--ttcgcc-----agtt--------------------------------
A0MK43_E1B19K-02        gcctccgcg-----gctggaccgagtggtggagg----------------
A0A0A1EUE4_E1B19K-      g--ttcgtc-----gctt--------------------------------
A0MK43_E1B19K-01        g--ttcgcc-----gctt--------------------------------
A0A2H5AID8_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIL0_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIC5_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AI40_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AII9_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIN5_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIU0_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIS9_E1B19K-      g--ttcgcc-----gctt--------------------------------
A0A2H5AIT6_E1B19K-      g--ttcgcc-----gctt--------------------------------
Q5C8R2_E1B19K-01        g--ttcggc-----gctt--------------------------------
A0A2H5AI21_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A0M5L3Y4_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A0A1EUC8_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A2H5AI04_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A2H5AI72_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A2H5AIL3_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A0A1EUB2_E1B19K-      g--ttcggc-----gctt--------------------------------
A0A0M4NHE0_E1B19K-      gcctccgct-----cgg---------------------------------
H9AAD9_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAK5_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAH3_E1B19K-01        gcctccgct-----cgg---------------------------------
F2WTJ7_E1B19K-01        gcctccgct-----cgg---------------------------------
F2WTM9_E1B19K-01        gcctccgct-----cgg---------------------------------
A0A1C8EG46_E1B19K-      gcctccgct-----cgg---------------------------------
H9AAA8_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AA76_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAN8_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAS0_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAV3_E1B19K-01        gcctccgct-----cgg---------------------------------
H9AAY5_E1B19K-01        gcctccgct-----cgg---------------------------------
M9YVA3_E1B19K-01        gcctccgct-----cgg---------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ---------------------------cttagga----------------
Q7T951_E1B19K-01        ---------------------------cttagga----------------
T1UE63_E1B19K-01        ---------------------------cttagga----------------
Q7T8D8_E1B19K-01        ---------------------------cttagga----------------
Q5UW22_E1B19K-01        ---------------------------cttagga----------------
Q8B8U7_E1B19K-01        ---------------------------cttagga----------------
Q32UI6_E1B19K-01        ---------------------------cttagaa----------------
A0A7G5FB98_E1B19K-      ---------------------------cttagaa----------------
A0A7G5F9T0_E1B19K-      ---------------------------cttagaa----------------
J7H4R9_E1B19K-01        ---------------------------cttagaa----------------
D2DM83_E1B19K-01        ---------------------------cttagaa----------------
J7I6W7_E1B19K-01        ---------------------------cttagaa----------------
C7SRS7_E1B19K-01        ---------------------------cttagaa----------------
A0A7U3S1T6_E1B19K-      ---------------------------cttagaa----------------
A0A7U3S224_E1B19K-      ---------------------------cttagaa----------------
W6EIX6_E1B19K-01        ---------------------------cttagaa----------------
A0A1L7NRH1_E1B19K-      ---------------------------cttagaa----------------
Q3ZL02_E1B19K-01        ---------------------------cttagaa----------------
T1UFS4_E1B19K-01        ---------------------------cttagaa----------------
T2CI10_E1B19K-01        ---------------------------cttaggc----------------
A0A0K0PX35_E1B19K-      ---------------------------cttagac----------------
A0A0K0PX99_E1B19K-      ---------------------------cttagac----------------
Q3ZKW2_E1B19K-01        ---------------------------ctgagac----------------
Q2KRU2_E1B19K-01        ---------------------------ctgagac----------------
K7NG43_E1B19K-01        ---------------------------ctgagac----------------
Q2KS85_E1B19K-01        ---------------------------ctgagac----------------
A0A0B4SJH1_E1B19K-      ---------------------------ctgaaac----------------
A0A075IQ70_E1B19K-      ---------------------------ctgaaac----------------
T1UIP3_E1B19K-01        ---------------------------ctgagac----------------
R4HLE1_E1B19K-01        ---------------------------ctcaggc----------------
Q5EY83_E1B19K-01        ---------------------------ctcagac----------------
Q2Y0J3_E1B19K-01        ---------------------------ctcagac----------------
R4HMC6_E1B19K-01        ---------------------------ctcagac----------------
A0A897JQR0_E1B19K-      ---------------------------ctcagac----------------
I1V161_E1B19K-01        ---------------------------ctcagac----------------
A0A5P8KYF0_E1B19K-      ---------------------------ctcagac----------------
J7I6S4_E1B19K-01        ---------------------------ctcagac----------------
A0A220VZ73_E1B19K-      ---------------------------ctcagac----------------
P03248_E1B19K-02        ---------------------------ctcagac----------------
Q6RK98_E1B19K-01        ---------------------------ctcagac----------------
J7I6Q4_E1B19K-01        ---------------------------ctcagac----------------
A0A8B0LCV0_E1B19K-      ---------------------------ctcagac----------------
J7ID56_E1B19K-01        ---------------------------ctcaaac----------------
I6LEP5_E1B19K-01        ---------------------------ctcagac----------------
A0A6M6AA96_E1B19K-      ---------------------------ctcagac----------------
A0A8B0LD36_E1B19K-      ---------------------------ctcagac----------------
A0A8B0LBX6_E1B19K-      ---------------------------ctcagac----------------
A0A8B0L9Y2_E1B19K-      ---------------------------ctcagac----------------
R4HLJ6_E1B19K-01        ---------------------------ctcagac----------------
R4HLA0_E1B19K-01        ---------------------------ctcagac----------------
Q2KSL3_E1B19K-01        ---------------------------ctcagac----------------
A0A5J6CTQ0_E1B19K-      ---------------------------ctcagac----------------
I6LES1_E1B19K-01        ---------------------------ctcagac----------------
T1UF50_E1B19K-01        ---------------------------ctcagac----------------
Q7T8D8_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
Q32UI6_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
A0A7G5FB98_E1B19K-      gcctttggg-----tgtagcgggaatcctgaggc----------------
J7I6W7_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
W6EIX6_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
Q3ZL02_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
T1UFS4_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
T1UE63_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
T1UJX4_E1B19K-02        gcctttggg-----tgtagcgggaatcctgaggc----------------
T2CI10_E1B19K-02        gcctctggg-----cgtagcagggatcctgagac----------------
Q2Y0J3_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q5EY83_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
J7ID56_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
I6LEP5_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q2KSL3_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
T1UF50_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
R4HLE1_E1B19K-02        gcctctagg-----agtagcagggatattgagac----------------
P03248_E1B19K-03        gcctctagg-----agtagcagggatactgagac----------------
Q6RK98_E1B19K-02        gcctctagg-----agtagcagggatactgagac----------------
J7I6Q4_E1B19K-02        gcctctagg-----agtagcagggatactgagac----------------
R4HMC6_E1B19K-02        gcctctagg-----agtagcagggatactgagac----------------
I1V161_E1B19K-02        gcctctagg-----agtagcagggatactgagac----------------
A0A5P8KYF0_E1B19K-      gcctctagg-----agtagcagggatactgagac----------------
J7I6S4_E1B19K-02        gcctctagg-----agtagcagggatactgagac----------------
A0A897JQR0_E1B19K-      gcctctagg-----agtagcagggatactgagac----------------
K7NG43_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q3ZKW2_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q2KRU2_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
T1UIP3_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
Q2KS85_E1B19K-02        gcctctggg-----agtagcagggatactgagac----------------
A0A0B4SJH1_E1B19K-      gcctctggg-----agtagcagggatactgagac----------------
A0A075IQ70_E1B19K-      gcctctggg-----agtagcagggatactgagac----------------
M9YVF6_E1B19K-01        ggtgcagcc-----------------------------------------
A0A0M3TH31_E1B19K-      ggtgcagcc-----------------------------------------
M9YXY5_E1B19K-01        ggtgcagcc-----------------------------------------
Q71BY5_E1B19K-01        tgaaccacc-----tacccttcacgaactgtatg----------atttag
Q71BY5_E1B19K-02        tgaaccacc-----tacccttcacgaactgtatg----------atttag
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        gcctcagct-----agggccggcggcgccgctggcgaggcaggggtcgca
A0A0M4N3Z1_E1B19K-      gcctcagct-----agggccggtggcgccgctggtgaggcaggggtcgca
Q8B6X5_E1B19K-01        gcctcagct-----agggccggtggcgccgctggtgaggcaggggtcgca
B9A5L5_E1B19K-01        tttacagcc-----agcagcgtcgggtcttcttc----------atctac
T1UGY3_E1B19K-01        tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YYY5_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YWY2_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YWR9_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YXN8_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P8C849_E1B19K-      tctacagcc-----agcagctttgggtcttcttc----------atctac
B9A5A7_E1B19K-01        tctacagcc-----agcagcttcgggtcttcttc----------atctac
T1UG22_E1B19K-01        tctacagcc-----agcagcttcgggtcttcttc----------atctac
M0QVG6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
X4YVU5_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUS9_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QU02_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------atctac
A0A291B0H2_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV87_E1B19K-01        tctacagcc-----agcagttccgggtcttcttc----------gtctac
T1UKV6_E1B19K-01        tctacagcc-----agcagttccgggtcttcttc----------gtctac
W8VNG2_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------atctac
F8UFP5_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------atctac
T1UGT5_E1B19K-01        tctacagcc-----agcagttccgggtcttcttc----------gtctac
T1UGX3_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
W8CZB0_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G3CK71_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QTS5_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV08_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G9JUV5_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G1FC01_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A0G2UY10_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A1J0MS84_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUJ3_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
H0PPE7_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UKP8_E1B19K-01        tctacagcc-----agcagctccaggtcttcttc----------gtctac
T1UHQ8_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
Q4KSL0_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHG3_E1B19K-01        tctacagcc-----agcagctccgggtcttcttt----------gtctac
A0A384ZUF2_E1B19K-      tctacagcc-----agcagctccggttcttcttc----------gtctac
M0QUN2_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E1CIM6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E1AI10_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
Q9YL99_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
K7ZLN6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E1CIR1_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A1Y1BXT7_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A8F5PHF8_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHH6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVT4_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1ULJ8_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E9P585_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
D4N3H6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
C4P207_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1ULP4_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A384ZUM9_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
B9A5Q1_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUB4_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVK6_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A3G8WIY5_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
X4Y9D2_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHL7_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A075TSZ1_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
F1DT57_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A3Q9FFS0_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUF3_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
E5RWD9_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
E5RWL1_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
B6DU90_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
B9A5T7_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
A0A7R6T9I9_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
B6C6W8_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
B9A681_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
A0A1Y1BYF1_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHZ2_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
B2VQE3_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QU76_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVC7_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QU41_E1B19K-01        tatacagcc-----agcagctccgggtcttcttc----------gtctac
A0A097I4T0_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
A0A3S6PYX7_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
C5HDR2_E1B19K-01        tatacagcc-----agcagttccgggtcttcttc----------gtctac
D3GBW3_E1B19K-01        tatacagcc-----agcagttccgggtcttcttc----------gtctac
T1UK99_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------atctac
G1FBW4_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UKQ0_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVP5_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
H5T740_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUW8_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E1CIJ0_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UGU0_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV47_E1B19K-01        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UGY3_E1B19K-02        tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P8C849_E1B19K-      tctacagcc-----agcagctttgggtcttcttc----------atctac
A0A1P7YYY5_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
T1UG22_E1B19K-02        tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YWR9_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YXN8_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
A0A1P7YWY2_E1B19K-      tctacagcc-----agcagcttcgggtcttcttc----------atctac
M0QU02_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------atctac
M0QUS9_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV47_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UGU0_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUW8_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVP5_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G1FBW4_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UKQ0_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
F8UFP5_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------atctac
T1UGT5_E1B19K-02        tctacagcc-----agcagttccgggtcttcttc----------gtctac
A0A384ZUM9_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV87_E1B19K-02        tctacagcc-----agcagttccgggtcttcttc----------gtctac
T1UKV6_E1B19K-02        tctacagcc-----agcagttccgggtcttcttc----------gtctac
A0A3S6PYX7_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
C5HDR2_E1B19K-02        tatacagcc-----agcagttccgggtcttcttc----------gtctac
A0A097I4T0_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHZ2_E1B19K-02        tatacagcc-----agcagctccgggtcttcttc----------gtctac
A0A3Q9FFS0_E1B19K-      tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVC7_E1B19K-02        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QU76_E1B19K-02        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QU41_E1B19K-02        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUJ3_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUF3_E1B19K-02        tatacagcc-----agcagctccgggtcttcttc----------gtctac
M0QTS5_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QV08_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UGX3_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G1FC01_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
G3CK71_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A0G2UY10_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1ULP4_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
F1DT57_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHQ8_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHL7_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A075TSZ1_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
C4P207_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A8F5PHF8_E1B19K-      tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHG3_E1B19K-02        tctacagcc-----agcagctccgggtcttcttt----------gtctac
A0A384ZUF2_E1B19K-      tctacagcc-----agcagctccggttcttcttc----------gtctac
M0QUN2_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E1AI10_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVK6_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UHH6_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UK99_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------atctac
M0QVG6_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1UKP8_E1B19K-02        tctacagcc-----agcagctccaggtcttcttc----------gtctac
W8CZB0_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QUB4_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
M0QVT4_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
E9P585_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
T1ULJ8_E1B19K-02        tctacagcc-----agcagctccgggtcttcttc----------gtctac
A0A7L4WIC2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
Q6WQ37_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
Q6VGV8_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A0G2R248_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7D0TN91_E1B19K-      actgttgtc---------------------ctcc----------gtccgc
A0A5K6WAR5_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3S9SND6_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3S9SNH4_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A513TZR1_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7L4WK62_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A291P1B2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
T1UG63_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HJZ5_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A8F9W8V2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3S9SP19_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A6M4W5T4_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7L4WG90_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A516UYM9_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
J9Z4H6_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A1U9ALK7_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A6M5E4Y6_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
P03247_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A3G8W3H5_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
E1U5L6_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A516UYI9_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HJ54_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
J9Z5H0_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A7L4WJT1_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7L4WIG2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3S9SPV1_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HK78_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HK00_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HJ63_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7D6TSN5_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A4P2SGW2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A2H4PJ75_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A7L4WGT1_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
J7I6T8_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
Q71BY5_E1B19K-04        actgttgtc---------------------ttcc----------gtccgc
A0A3S9SSS2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
E1ARN8_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
J9Z4N4_E1B19K-01        actgttgtc---------------------ttcc----------gtccgc
A0A3Q9HLF7_E1B19K-      actgttgtc---------------------ttcc----------gtcagc
A0A3S9SNY0_E1B19K-      actgttgtc---------------------ttcc----------gtcagc
A0A7D0TLU2_E1B19K-      actgttgtc---------------------tgcc----------gtccac
J9Z4N4_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
E1ARN8_E1B19K-03        actgttgtc---------------------ttcc----------gtccgc
E1ARN8_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
E1ARN8_E1B19K-04        actgttgtc---------------------ttcc----------gtccgc
J9Z4H6_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
Q6VGV8_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
A0A0G2R248_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
A0A4P2SGW2_E1B19K-      actgttgtc---------------------ttcc----------gtccgc
J7I6T8_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
T1UG63_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
E1U5L6_E1B19K-03        actgttgtc---------------------ttcc----------gtccgc
J9Z5H0_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
E1U5L6_E1B19K-02        actgttgtc---------------------ttcc----------gtccgc
E1U5L6_E1B19K-04        actgttgtc---------------------ttcc----------gtccgc
D3JIR7_E1B19K-02        ggcgcggcc---------------------tttg----------accatg
D3JIR7_E1B19K-01        ----cagct---------------------ctt-----------------
A0A076V686_E1B19K-      ----cagct---------------------ctt-----------------
A0A5H2QAX5_E1B19K-      ggcgcggcc---------------------tcta----------accatg
T1UEX7_E1B19K-02        ggcgcggcc---------------------tcta----------accatg
P04492_E1B19K-02        ggcgcggcc---------------------tttg----------accatg
G1DE13_E1B19K-01        ----cagct---------------------tct-----------------
A0A5H2QAX5_E1B19K-      ----cagct---------------------tct-----------------
D0Z5R9_E1B19K-01        ----cagct---------------------tct-----------------
T1UEX7_E1B19K-01        ----cagct---------------------tct-----------------
A0A3G8WH01_E1B19K-      ----cagct---------------------ctt-----------------
P04492_E1B19K-01        ----cagct---------------------ctt-----------------

Q7T8D8_E1B19K-03        ----cgctaacactgtgcttgg----------------------------
Q6RK98_E1B19K-03        ----cgccaacactatccttgg----------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        -aagcccaagcactgctga-------------------------------
Q695T5_E1B19K-02        -aagctcaagtgctgctga-------------------------------
F2WTG5_E1B19K-01        -aagctcaagtgctgctga-------------------------------
Q695T5_E1B19K-01        -aagctcaagtgctgctga-------------------------------
H9TER0_E1B19K-01        -aagctcaagtgctgctga-------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        --------------------------------------------------
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      -----gctggcgtcggtggcgg---------------------------a
H9AAD9_E1B19K-01        -----gctggcgtcggtggcgg---------------------------a
H9AAK5_E1B19K-01        -----gctggcgtcggtggcgg---------------------------a
H9AAH3_E1B19K-01        -----gctggcgtcggtggcgg---------------------------a
F2WTJ7_E1B19K-01        -----gcgggcatcgttgccgg---------------------------a
F2WTM9_E1B19K-01        -----gcgggcatcgttgccgg---------------------------a
A0A1C8EG46_E1B19K-      -----gcgggcatcttcgccgg---------------------------a
H9AAA8_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
H9AA76_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
H9AAN8_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
H9AAS0_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
H9AAV3_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
H9AAY5_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
M9YVA3_E1B19K-01        -----gcgggcatcgtcgccgg---------------------------a
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        --------------------------------------------------
Q32UI6_E1B19K-02        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
J7I6W7_E1B19K-02        --------------------------------------------------
W6EIX6_E1B19K-02        --------------------------------------------------
Q3ZL02_E1B19K-02        --------------------------------------------------
T1UFS4_E1B19K-02        --------------------------------------------------
T1UE63_E1B19K-02        --------------------------------------------------
T1UJX4_E1B19K-02        --------------------------------------------------
T2CI10_E1B19K-02        --------------------------------------------------
Q2Y0J3_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------------------------------------------------
J7ID56_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-02        --------------------------------------------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------------------------------------------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------------------------------------------------
Q2KSL3_E1B19K-02        --------------------------------------------------
T1UF50_E1B19K-02        --------------------------------------------------
R4HLE1_E1B19K-02        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
J7I6Q4_E1B19K-02        --------------------------------------------------
R4HMC6_E1B19K-02        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-02        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
K7NG43_E1B19K-02        --------------------------------------------------
Q3ZKW2_E1B19K-02        --------------------------------------------------
Q2KRU2_E1B19K-02        --------------------------------------------------
T1UIP3_E1B19K-02        --------------------------------------------------
Q2KS85_E1B19K-02        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
M9YVF6_E1B19K-01        ---------tcagcaaggtctg----------------------------
A0A0M3TH31_E1B19K-      ---------tcagcgaggtctg----------------------------
M9YXY5_E1B19K-01        ---------tcagcgaggtctg----------------------------
Q71BY5_E1B19K-01        acgtgacggcccccgaagatcc----------------------------
Q71BY5_E1B19K-02        acgtgacggcccccgaagatcc----------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        gcaggaggagcagcagcagcgg----------------------------
A0A0M4N3Z1_E1B19K-      gcaggaggagcagcagcagcag----------------------------
Q8B6X5_E1B19K-01        gcaggaggagcagcagcagcag----------------------------
B9A5L5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UGY3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A1P7YYY5_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YWY2_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YWR9_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YXN8_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P8C849_E1B19K-      acag-acaaacatccatgttgg----------------------------
B9A5A7_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UG22_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QVG6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
X4YVU5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QUS9_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QU02_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A291B0H2_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QV87_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UKV6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
W8VNG2_E1B19K-01        acag-acaaacatccatgttgg----------------------------
F8UFP5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UGT5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UGX3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
W8CZB0_E1B19K-01        acag-acaaacatccatgttgg----------------------------
G3CK71_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QTS5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QV08_E1B19K-01        acag-acaaacatccatgttgg----------------------------
G9JUV5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
G1FC01_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A0G2UY10_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1J0MS84_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QUJ3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
H0PPE7_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UKP8_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UHQ8_E1B19K-01        acag-acaaacatccatgttgg----------------------------
Q4KSL0_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UHG3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A384ZUF2_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QUN2_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E1CIM6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E1AI10_E1B19K-01        acag-acaaacatccatgttgg----------------------------
Q9YL99_E1B19K-01        acag-acaaacatccatgttgg----------------------------
K7ZLN6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E1CIR1_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A1Y1BXT7_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A8F5PHF8_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1UHH6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QVT4_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1ULJ8_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E9P585_E1B19K-01        acag-acaaacatccatgttgg----------------------------
D4N3H6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
C4P207_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1ULP4_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A384ZUM9_E1B19K-      acag-acaaacatccatgttgg----------------------------
B9A5Q1_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QUB4_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QVK6_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A3G8WIY5_E1B19K-      acag-acaaacatccatgttgg----------------------------
X4Y9D2_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UHL7_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A075TSZ1_E1B19K-      acag-acaaacatccatgttgg----------------------------
F1DT57_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A3Q9FFS0_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QUF3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E5RWD9_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E5RWL1_E1B19K-01        acag-acaaacatccatgttgg----------------------------
B6DU90_E1B19K-01        acag-acaaacatccatgttgg----------------------------
B9A5T7_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A7R6T9I9_E1B19K-      acag-acaaacatccatgttgg----------------------------
B6C6W8_E1B19K-01        acag-acaaacatccatgttgg----------------------------
B9A681_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A1Y1BYF1_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1UHZ2_E1B19K-01        acag-acaaacatccatgttgg----------------------------
B2VQE3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QU76_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QVC7_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QU41_E1B19K-01        acag-acaaacatccatgttgg----------------------------
A0A097I4T0_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A3S6PYX7_E1B19K-      acag-acaaacatccatgttgg----------------------------
C5HDR2_E1B19K-01        acag-acaaacatccatgttgg----------------------------
D3GBW3_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UK99_E1B19K-01        acag-acaaacatccatgttgg----------------------------
G1FBW4_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UKQ0_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QVP5_E1B19K-01        acag-acaaacatccatgttgg----------------------------
H5T740_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QUW8_E1B19K-01        acag-acaaacatccatgttgg----------------------------
E1CIJ0_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UGU0_E1B19K-01        acag-acaaacatccatgttgg----------------------------
M0QV47_E1B19K-01        acag-acaaacatccatgttgg----------------------------
T1UGY3_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A1P8C849_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YYY5_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1UG22_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A1P7YWR9_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YXN8_E1B19K-      acag-acaaacatccatgttgg----------------------------
A0A1P7YWY2_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QU02_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QUS9_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QV47_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UGU0_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QUW8_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QVP5_E1B19K-02        acag-acaaacatccatgttgg----------------------------
G1FBW4_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UKQ0_E1B19K-02        acag-acaaacatccatgttgg----------------------------
F8UFP5_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UGT5_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A384ZUM9_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QV87_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UKV6_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A3S6PYX7_E1B19K-      acag-acaaacatccatgttgg----------------------------
C5HDR2_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A097I4T0_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1UHZ2_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A3Q9FFS0_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QVC7_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QU76_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QU41_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QUJ3_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QUF3_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QTS5_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QV08_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UGX3_E1B19K-02        acag-acaaacatccatgttgg----------------------------
G1FC01_E1B19K-02        acag-acaaacatccatgttgg----------------------------
G3CK71_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A0G2UY10_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1ULP4_E1B19K-02        acag-acaaacatccatgttgg----------------------------
F1DT57_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UHQ8_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UHL7_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A075TSZ1_E1B19K-      acag-acaaacatccatgttgg----------------------------
C4P207_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A8F5PHF8_E1B19K-      acag-acaaacatccatgttgg----------------------------
T1UHG3_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A384ZUF2_E1B19K-      acag-acaaacatccatgttgg----------------------------
M0QUN2_E1B19K-02        acag-acaaacatccatgttgg----------------------------
E1AI10_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QVK6_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UHH6_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UK99_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QVG6_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1UKP8_E1B19K-02        acag-acaaacatccatgttgg----------------------------
W8CZB0_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QUB4_E1B19K-02        acag-acaaacatccatgttgg----------------------------
M0QVT4_E1B19K-02        acag-acaaacatccatgttgg----------------------------
E9P585_E1B19K-02        acag-acaaacatccatgttgg----------------------------
T1ULJ8_E1B19K-02        acag-acaaacatccatgttgg----------------------------
A0A7L4WIC2_E1B19K-      ccggcaataataccgacggagc---------------agcagcagcagca
Q6WQ37_E1B19K-01        ccggcgataataccgacggagg---------------------------a
Q6VGV8_E1B19K-01        ccggcgataataccgacggagg---------------------------a
A0A0G2R248_E1B19K-      ccggcgataataccgacggagg---------------------------a
A0A7D0TN91_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A5K6WAR5_E1B19K-      ccggcaataataccgacggagg---------------------------a
A0A3S9SND6_E1B19K-      ccggcaataataccgacggagg---------------------agcagca
A0A3S9SNH4_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A513TZR1_E1B19K-      ccggcaataataccgacggagg---------------agcagcagcagca
A0A7L4WK62_E1B19K-      ccggcaataatacggacggagg------------------------agca
A0A291P1B2_E1B19K-      ccggcaataataccgacggagg----------------------------
T1UG63_E1B19K-01        ccggcaataataccgacggagg------------------agcagcagca
A0A3Q9HJZ5_E1B19K-      ccggcaataataccgacggagg---------------agcagcagcagca
A0A8F9W8V2_E1B19K-      ccggcaataataccgacggagg----------------------------
A0A3S9SP19_E1B19K-      ccggcaataataccgacggagg----------------------------
A0A6M4W5T4_E1B19K-      ccggcaataataccgacggagg---------------------agcagca
A0A7L4WG90_E1B19K-      ccggcaataataccgacggagg---------agcagcagcagcagcagca
A0A516UYM9_E1B19K-      ccggcaataataccgacggaag---------------agcagcagcagca
J9Z4H6_E1B19K-01        ccggcaataataccgacggaag---------------agcagcagcagca
A0A1U9ALK7_E1B19K-      ccggcaataataccgacggagg----------------------------
A0A6M5E4Y6_E1B19K-      ccggcaataataccgacggagg----------------------------
P03247_E1B19K-01        ccggcaataataccgacggagg----------------------------
A0A3G8W3H5_E1B19K-      ccggcaataataccgacggagg----------------------------
E1U5L6_E1B19K-01        ccggcaataataccgacggagg----------------------------
A0A516UYI9_E1B19K-      ccggcaataataccgacggagg----------------------------
A0A3Q9HJ54_E1B19K-      ccggcaataataccgacggagg----------------------------
J9Z5H0_E1B19K-01        ccggcaataataccgacggagg----------------------------
A0A7L4WJT1_E1B19K-      ccggcaataataccgacggagg------agcagcagcagcagcagcagca
A0A7L4WIG2_E1B19K-      ccggcaataataccgacggagg---------------------agcagca
A0A3S9SPV1_E1B19K-      ccggcaataataccgacggaggagcagcagcagcagcagcagcagcagca
A0A3Q9HK78_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A3Q9HK00_E1B19K-      ccggcaataataccgacggagg---------------agcagcagcagca
A0A3Q9HJ63_E1B19K-      ccggcaataataccgacggagg------------agcagcagcagcagca
A0A7D6TSN5_E1B19K-      ccggcaataataccgacggagg---------------agcagcagcagca
A0A4P2SGW2_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A2H4PJ75_E1B19K-      ccggcaataataccgacggagg------------------------agca
A0A7L4WGT1_E1B19K-      ccggcaataataccgacggagg----------------------------
J7I6T8_E1B19K-01        ccggcaataataccgacggagg---------------------agcagca
Q71BY5_E1B19K-04        ccggcaataataccgacggagg------------------agcagcagca
A0A3S9SSS2_E1B19K-      ccggc---aataccgacggagg------------------agcagcagca
E1ARN8_E1B19K-01        ccggcaataataccgacggagg------------------agcagcagca
J9Z4N4_E1B19K-01        ccggcaataataccgacggagg------------------agcag-----
A0A3Q9HLF7_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A3S9SNY0_E1B19K-      ccggcaataataccgacggagg------------------agcagcagca
A0A7D0TLU2_E1B19K-      cttgcaataataccgacgttat----------------------------
J9Z4N4_E1B19K-02        ccggcaataataccgacggagg---------------------agcag--
E1ARN8_E1B19K-03        ccggcaataataccgacggagg---------------------agcagca
E1ARN8_E1B19K-02        ccggcaataataccgacggagg---------------------agcagca
E1ARN8_E1B19K-04        ccggcaataataccgacggagg---------------------agcagca
J9Z4H6_E1B19K-02        ccggcaataataccgacggaag------------------agcagcagca
Q6VGV8_E1B19K-02        ccggcgataataccgacggagg----------------------------
A0A0G2R248_E1B19K-      ccggcgataataccgacggagg----------------------------
A0A4P2SGW2_E1B19K-      ccggcaataataccgacggagg---------------------agcagca
J7I6T8_E1B19K-02        ccggcaataataccgacggagg------------------------agca
T1UG63_E1B19K-02        ccggcaataataccgacggagg---------------------agcagca
E1U5L6_E1B19K-03        ccggcaataataccgacggagg----------------------------
J9Z5H0_E1B19K-02        ccggcaataataccgacggagg----------------------------
E1U5L6_E1B19K-02        ccggcaataataccgacggagg----------------------------
E1U5L6_E1B19K-04        ccggcaataataccgacggagg----------------------------
D3JIR7_E1B19K-02        ccgcgactgccaacgttgcagg---------------------------a
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      ccgccgttgc----------------------------------------
T1UEX7_E1B19K-02        ccgccgttgc----------------------------------------
P04492_E1B19K-02        ccgccgctgccgacgttgcaag---------------------------a
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        --------aatgggttactatggaagca----------------------
Q6RK98_E1B19K-03        --------aatgggctattacggaagca----------------------
A0A097IW62_E1B19K-      --------cggaggcggttgggaatgccaacggacgacagggtttgcctg
A0A0M3TH18_E1B19K-      --------cggaggcggttggggttcaagacagaggaccaaacgcgcttg
A0A1W5PVU4_E1B19K-      --------cggaggcggctggggttccagacagaggatcaaacccgcttg
A0A2H4CJZ0_E1B19K-      --------tggaggagccggagccggagg---------------------
H8PFZ1_E1B19K-01        --------tggaggagtcggagctggagg---------------------
G0ZAH2_E1B19K-01        --------accgggagatcaggcgggagg---------------------
F6KST6_E1B19K-01        --------ggcaggaggagctggaaacaatattggaggagga-agcaatg
Q695T5_E1B19K-02        --------ggcgggaggatctggaagccatttcggaggaggagagc----
F2WTG5_E1B19K-01        --------ggcgggaggatctggaggccatttcggaggaggagagc----
Q695T5_E1B19K-01        --------ggcgggaggatctggaagccatttcggaggaggagagc----
H9TER0_E1B19K-01        --------ggcgggaggatctggaagccatttcggaggaggagagc----
A0A1L3INW0_E1B19K-      -----------------tgtcgcggtggggagccctggag----------
P10543_E1B19K-01        -----------------tgctggagttgg---------------------
A0A6M6AEV2_E1B19K-      -----------------tgctggagttgg---------------------
A0A142G3J2_E1B19K-      -----------------tgctggagttgg---------------------
A0A7U3RVU4_E1B19K-      -----------------tgctggagttgg---------------------
A0A482EVC6_E1B19K-      --------tggatccagtgcgggaggaggaggaggaggag----------
A0A7U3RWV6_E1B19K-      -----------------tgctggagttgg---------------------
A0A1S6ELT2_E1B19K-      -----------------tgctggagttgg---------------------
A0A3G4W995_E1B19K-      -----------------tgctggagttgg---------------------
A0A898KBW7_E1B19K-      -----------------tgctggagttgg---------------------
A0A3G8W407_E1B19K-      -----------------tgctggagttgg---------------------
F4ZCJ8_E1B19K-01        -----------------tgctggagttgg---------------------
A0A6B9DS29_E1B19K-      -----------------tgctggagttgg---------------------
A0A8G1GLF6_E1B19K-      -----------------tgctggagttgg---------------------
B5SNR1_E1B19K-01        -----------------tgctggagttgg---------------------
P10544_E1B19K-01        -----------------tgctggagttgg---------------------
A0A482EVC6_E1B19K-      -----------------tgctggagttgg---------------------
A0A898KBR0_E1B19K-      -----------------tgctggagttgg---------------------
A0A898KBS1_E1B19K-      -----------------tgctggagttgg---------------------
W0S1G8_E1B19K-01        -----------------tgctggagttgg---------------------
A0A6M6AES6_E1B19K-      -----------------tgctggagttgg---------------------
A0A2H5AI99_E1B19K-      ---------------gctggagtcggcg----------------------
A0MK43_E1B19K-02        --------agaacgagccggaggagaccg---------------------
A0A0A1EUE4_E1B19K-      ---------------gctggagttggcc----------------------
A0MK43_E1B19K-01        ---------------gctggagttggcc----------------------
A0A2H5AID8_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIL0_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIC5_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AI40_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AII9_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIN5_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIU0_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIS9_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIT6_E1B19K-      ---------------gctggagttggcc----------------------
Q5C8R2_E1B19K-01        ---------------gctggagttggcc----------------------
A0A2H5AI21_E1B19K-      ---------------gctggagttggcc----------------------
A0A0M5L3Y4_E1B19K-      ---------------gctggagttggcc----------------------
A0A0A1EUC8_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AI04_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AI72_E1B19K-      ---------------gctggagttggcc----------------------
A0A2H5AIL3_E1B19K-      ---------------gctggagttggcc----------------------
A0A0A1EUB2_E1B19K-      ---------------gttggagttggcc----------------------
A0A0M4NHE0_E1B19K-      ggagcgttcggaggaatccaagccggaggtgaacccggag----------
H9AAD9_E1B19K-01        ggagcgttcggaggaatccaagccggaggtgaacccggag----------
H9AAK5_E1B19K-01        ggagcgttcggaggaatccaagccggaggtgaacccggag----------
H9AAH3_E1B19K-01        ggagcgttcggaggaatccaagccggaggtgaacccggag----------
F2WTJ7_E1B19K-01        ggagcagtcgccggaggtgaagccgaaggt------ggcg----------
F2WTM9_E1B19K-01        ggagcagtcgccggaggtgaagccgaaggt------ggcg----------
A0A1C8EG46_E1B19K-      ggagcagttgccggaggtgaagccggaggt------ggcg----------
H9AAA8_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
H9AA76_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
H9AAN8_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
H9AAS0_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
H9AAV3_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
H9AAY5_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
M9YVA3_E1B19K-01        ggagcagtcgccggaggtgaagccggaggt------ggcg----------
Q6QPF3_E1B19K-01        ---------------gactagacag-------------------------
Q6QPB7_E1B19K-01        ---------------gactagacag-------------------------
Q6QPI9_E1B19K-01        ---------------gactagacag-------------------------
G9G841_E1B19K-01        ---------------gactagacag-------------------------
Q8UY91_E1B19K-01        ---------------gactagacag-------------------------
P10406_E1B19K-01        ---------------gactaggcag-------------------------
Q5GFC7_E1B19K-02        ---------------gactaggcag-------------------------
A0A2R3WN62_E1B19K-      ---------------gactaggcag-------------------------
A0A3G9CMQ4_E1B19K-      ---------------gactaggcag-------------------------
Q5GFC7_E1B19K-01        ---------------gactaggcag-------------------------
Q5GFC8_E1B19K-01        ---------------gactaggcag-------------------------
Q6H1D7_E1B19K-01        ---------------gactaggcag-------------------------
A0A3G9JTX5_E1B19K-      ---------------gactaggcag-------------------------
Q2KSM8_E1B19K-02        ---------------gactaggcag-------------------------
A0A2R3WNP3_E1B19K-      ---------------gactaggcag-------------------------
A0A3G8W6L2_E1B19K-      ---------------gactaggcag-------------------------
A0A3G9K5X3_E1B19K-      ---------------gactaggcag-------------------------
Q2KSG6_E1B19K-01        ---------------gactaggcag-------------------------
Q2KSM8_E1B19K-01        ---------------gactaggcag-------------------------
A0A2R3WN16_E1B19K-      ---------------gactaggcag-------------------------
Q2KSG6_E1B19K-02        ---------------gactaggcag-------------------------
A0A2L1F392_E1B19K-      ---------------gactaggcag-------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------a------gactaggcaa-------------------------
Q7T951_E1B19K-01        --------a------gactaggcaa-------------------------
T1UE63_E1B19K-01        --------a------gactaggcaa-------------------------
Q7T8D8_E1B19K-01        --------a------gactaggcaa-------------------------
Q5UW22_E1B19K-01        --------a------gactaggcaa-------------------------
Q8B8U7_E1B19K-01        --------a------gactaggcaa-------------------------
Q32UI6_E1B19K-01        --------a------gactaggcaa-------------------------
A0A7G5FB98_E1B19K-      --------a------gactaggcaa-------------------------
A0A7G5F9T0_E1B19K-      --------a------gactaggcaa-------------------------
J7H4R9_E1B19K-01        --------a------gactaggcaa-------------------------
D2DM83_E1B19K-01        --------a------gactaggcaa-------------------------
J7I6W7_E1B19K-01        --------a------gactaggcaa-------------------------
C7SRS7_E1B19K-01        --------a------gactaggcaa-------------------------
A0A7U3S1T6_E1B19K-      --------a------gactaggcaa-------------------------
A0A7U3S224_E1B19K-      --------a------gactaggcaa-------------------------
W6EIX6_E1B19K-01        --------a------gactaggcaa-------------------------
A0A1L7NRH1_E1B19K-      --------a------gactaggcaa-------------------------
Q3ZL02_E1B19K-01        --------a------gactaggcaa-------------------------
T1UFS4_E1B19K-01        --------a------gactaggcaa-------------------------
T2CI10_E1B19K-01        --------a------gactaggcaa-------------------------
A0A0K0PX35_E1B19K-      --------a------gactaggcta-------------------------
A0A0K0PX99_E1B19K-      --------a------gactaggcta-------------------------
Q3ZKW2_E1B19K-01        --------a------gactaggcta-------------------------
Q2KRU2_E1B19K-01        --------a------gactaggcta-------------------------
K7NG43_E1B19K-01        --------a------gactaggcta-------------------------
Q2KS85_E1B19K-01        --------a------gactaggcta-------------------------
A0A0B4SJH1_E1B19K-      --------a------gactaggcta-------------------------
A0A075IQ70_E1B19K-      --------a------gactaggcta-------------------------
T1UIP3_E1B19K-01        --------a------gactaggcta-------------------------
R4HLE1_E1B19K-01        --------a------gactaggcta-------------------------
Q5EY83_E1B19K-01        --------a------gactaggcta-------------------------
Q2Y0J3_E1B19K-01        --------a------gactaagcta-------------------------
R4HMC6_E1B19K-01        --------a------gactaggcta-------------------------
A0A897JQR0_E1B19K-      --------a------gactaggcta-------------------------
I1V161_E1B19K-01        --------a------gactaggcta-------------------------
A0A5P8KYF0_E1B19K-      --------a------gactaggcta-------------------------
J7I6S4_E1B19K-01        --------a------gactaggcta-------------------------
A0A220VZ73_E1B19K-      --------a------gactaggcta-------------------------
P03248_E1B19K-02        --------a------gactaggcta-------------------------
Q6RK98_E1B19K-01        --------a------gactaggcta-------------------------
J7I6Q4_E1B19K-01        --------a------gactaggcta-------------------------
A0A8B0LCV0_E1B19K-      --------a------gactaggcta-------------------------
J7ID56_E1B19K-01        --------a------gactaggcta-------------------------
I6LEP5_E1B19K-01        --------a------gactaggcta-------------------------
A0A6M6AA96_E1B19K-      --------a------gactaggcta-------------------------
A0A8B0LD36_E1B19K-      --------a------gactaggcta-------------------------
A0A8B0LBX6_E1B19K-      --------a------gactaggcta-------------------------
A0A8B0L9Y2_E1B19K-      --------a------gactaggcta-------------------------
R4HLJ6_E1B19K-01        --------a------gactaggcta-------------------------
R4HLA0_E1B19K-01        --------a------gactaggcta-------------------------
Q2KSL3_E1B19K-01        --------a------gactaggcta-------------------------
A0A5J6CTQ0_E1B19K-      --------a------gactaggcta-------------------------
I6LES1_E1B19K-01        --------a------gactaggcta-------------------------
T1UF50_E1B19K-01        --------a------gactaggcta-------------------------
Q7T8D8_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
Q32UI6_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
A0A7G5FB98_E1B19K-      --------atccaccggtcatgccagcggttctggaggag----------
J7I6W7_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
W6EIX6_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
Q3ZL02_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
T1UFS4_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
T1UE63_E1B19K-02        --------atccaccggtcatgccagcggttctggaggag----------
T1UJX4_E1B19K-02        --------atccacctgtcatgccagcggttctggaggag----------
T2CI10_E1B19K-02        --------acccaccgaccatgccagcggttttggaggag----------
Q2Y0J3_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
Q5EY83_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
J7ID56_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
I6LEP5_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
Q2KSL3_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
T1UF50_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
R4HLE1_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
P03248_E1B19K-03        --------acccacctaccatgccagcggttctgcaggag----------
Q6RK98_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
J7I6Q4_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
R4HMC6_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
I1V161_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
A0A5P8KYF0_E1B19K-      --------acccaccgaccatgccagcggttctgcaggag----------
J7I6S4_E1B19K-02        --------acccaccgaccatgccagcggttctgcaggag----------
A0A897JQR0_E1B19K-      --------acccaccgaccatgccagcggttctgcaggag----------
K7NG43_E1B19K-02        --------acccaccggccatgccagcggttctggaggag----------
Q3ZKW2_E1B19K-02        --------acccaccgaccatgccagcggttctggaggag----------
Q2KRU2_E1B19K-02        --------acccaccggccatgccagcggttctggaggag----------
T1UIP3_E1B19K-02        --------acccaccggccatgccagcggttctggaggag----------
Q2KS85_E1B19K-02        --------acccaccggccatgccagcggttctggaggag----------
A0A0B4SJH1_E1B19K-      --------acccaccggccatgccagcggttctggaggag----------
A0A075IQ70_E1B19K-      --------acccaccggccatgccagcggttctggaggag----------
M9YVF6_E1B19K-01        -gagcgagtggaggaagaggaggag-------------------------
A0A0M3TH31_E1B19K-      -gagcgagtggaggaagaggaggagg------------------------
M9YXY5_E1B19K-01        -gagcgagtggaggaagaggaggagg------------------------
Q71BY5_E1B19K-01        ---caacgaggaggcggtttcgcagattt---------------------
Q71BY5_E1B19K-02        ---caacgaggaggcggtttcgcagattt---------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        ----caggaggaggagcaggtgcagg------------------------
A0A0M4N3Z1_E1B19K-      -cgtcaggaggagcagcaggtgcagg------------------------
Q8B6X5_E1B19K-01        -cgtcaggaggagcagcaggtgcagg------------------------
B9A5L5_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
T1UGY3_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
A0A1P7YYY5_E1B19K-      --------aggaagaaataagggaggcca---------------------
A0A1P7YWY2_E1B19K-      --------aggaagaaatgagggagtcca---------------------
A0A1P7YWR9_E1B19K-      --------aggaagaaatgagggaggcca---------------------
A0A1P7YXN8_E1B19K-      --------aggaagaaatgagggaggcca---------------------
A0A1P8C849_E1B19K-      --------aggaagaaatgagggaggcca---------------------
B9A5A7_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
T1UG22_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
M0QVG6_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
X4YVU5_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
M0QUS9_E1B19K-01        --------aggaagagatgagggaggcca---------------------
M0QU02_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
A0A291B0H2_E1B19K-      --------aggaagaaatgagggaggcca---------------------
M0QV87_E1B19K-01        --------aggaagagatgagggaggcca---------------------
T1UKV6_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
W8VNG2_E1B19K-01        --------aggaagagatgagggaggcca---------------------
F8UFP5_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
T1UGT5_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
T1UGX3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
W8CZB0_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
G3CK71_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QTS5_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QV08_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
G9JUV5_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
G1FC01_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A0G2UY10_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
A0A1J0MS84_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QUJ3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
H0PPE7_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1UKP8_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1UHQ8_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
Q4KSL0_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1UHG3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A384ZUF2_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QUN2_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E1CIM6_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E1AI10_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
Q9YL99_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
K7ZLN6_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E1CIR1_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A1Y1BXT7_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
A0A8F5PHF8_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
T1UHH6_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QVT4_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1ULJ8_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E9P585_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
D4N3H6_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
C4P207_E1B19K-01        --------aggaagaaatgagacaggcca---------------------
T1ULP4_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A384ZUM9_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
B9A5Q1_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QUB4_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QVK6_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A3G8WIY5_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
X4Y9D2_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1UHL7_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A075TSZ1_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
F1DT57_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A3Q9FFS0_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QUF3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E5RWD9_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
E5RWL1_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
B6DU90_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
B9A5T7_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A7R6T9I9_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
B6C6W8_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
B9A681_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A1Y1BYF1_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
T1UHZ2_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
B2VQE3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QU76_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QVC7_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QU41_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
A0A097I4T0_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
A0A3S6PYX7_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
C5HDR2_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
D3GBW3_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
T1UK99_E1B19K-01        --------aggaagaaatgagggaggcca---------------------
G1FBW4_E1B19K-01        --------aggaagagatgagggaggcca---------------------
T1UKQ0_E1B19K-01        --------aggaagagatgagggaggcca---------------------
M0QVP5_E1B19K-01        --------aggaagagatgagggaggcca---------------------
H5T740_E1B19K-01        --------aggaagaaatgaggcaggcca---------------------
M0QUW8_E1B19K-01        --------aggaagagatgagggaggcca---------------------
E1CIJ0_E1B19K-01        --------aggaagagatgagggaggcca---------------------
T1UGU0_E1B19K-01        --------aggaagagatgagggaggcca---------------------
M0QV47_E1B19K-01        --------aggaagagatgagggagacca---------------------
T1UGY3_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
A0A1P8C849_E1B19K-      --------aggaagaaatgagggaggcca---------------------
A0A1P7YYY5_E1B19K-      --------aggaagaaataagggaggcca---------------------
T1UG22_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
A0A1P7YWR9_E1B19K-      --------aggaagaaatgagggaggcca---------------------
A0A1P7YXN8_E1B19K-      --------aggaagaaatgagggaggcca---------------------
A0A1P7YWY2_E1B19K-      --------aggaagaaatgagggagtcca---------------------
M0QU02_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
M0QUS9_E1B19K-02        --------aggaagagatgagggaggcca---------------------
M0QV47_E1B19K-02        --------aggaagagatgagggagacca---------------------
T1UGU0_E1B19K-02        --------aggaagagatgagggaggcca---------------------
M0QUW8_E1B19K-02        --------aggaagagatgagggaggcca---------------------
M0QVP5_E1B19K-02        --------aggaagagatgagggaggcca---------------------
G1FBW4_E1B19K-02        --------aggaagagatgagggaggcca---------------------
T1UKQ0_E1B19K-02        --------aggaagagatgagggaggcca---------------------
F8UFP5_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
T1UGT5_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
A0A384ZUM9_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QV87_E1B19K-02        --------aggaagagatgagggaggcca---------------------
T1UKV6_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
A0A3S6PYX7_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
C5HDR2_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A097I4T0_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
T1UHZ2_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A3Q9FFS0_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QVC7_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QU76_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QU41_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QUJ3_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QUF3_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QTS5_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QV08_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1UGX3_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
G1FC01_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
G3CK71_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A0G2UY10_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
T1ULP4_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
F1DT57_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1UHQ8_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1UHL7_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A075TSZ1_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
C4P207_E1B19K-02        --------aggaagaaatgagacaggcca---------------------
A0A8F5PHF8_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
T1UHG3_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A384ZUF2_E1B19K-      --------aggaagaaatgaggcaggcca---------------------
M0QUN2_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
E1AI10_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QVK6_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1UHH6_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1UK99_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
M0QVG6_E1B19K-02        --------aggaagaaatgagggaggcca---------------------
T1UKP8_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
W8CZB0_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QUB4_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
M0QVT4_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
E9P585_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
T1ULJ8_E1B19K-02        --------aggaagaaatgaggcaggcca---------------------
A0A7L4WIC2_E1B19K-      gcagcagcagcagcagcaggaggaagcca---ggcggcgg----------
Q6WQ37_E1B19K-01        gcag---cagcagcagcaggaggaagcca------ggcgg----------
Q6VGV8_E1B19K-01        gcag---cagcagcagcaggaggaagcca------ggcgg----------
A0A0G2R248_E1B19K-      gcag---cagcagcagcaggaggaagcca------ggcgg----------
A0A7D0TN91_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A5K6WAR5_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3S9SND6_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3S9SNH4_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A513TZR1_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A7L4WK62_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A291P1B2_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
T1UG63_E1B19K-01        gcag---cagcagcagcaggaggaagccaggcggcggcgg----------
A0A3Q9HJZ5_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A8F9W8V2_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A3S9SP19_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A6M4W5T4_E1B19K-      gcag---cagcagcagcaggaggaaacca---ggcggcgg----------
A0A7L4WG90_E1B19K-      gcag---cagcagcagcaggaggaagcca---gacggcgg----------
A0A516UYM9_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
J9Z4H6_E1B19K-01        gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A1U9ALK7_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A6M5E4Y6_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
P03247_E1B19K-01        --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A3G8W3H5_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
E1U5L6_E1B19K-01        --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A516UYI9_E1B19K-      --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A3Q9HJ54_E1B19K-      --------agcaacagcaggaggaagccaggcggcggcgg----------
J9Z5H0_E1B19K-01        --------agcaacagcaggaggaagcca---ggcggcgg----------
A0A7L4WJT1_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A7L4WIG2_E1B19K-      gcag---cagcagctgcaggaggaagcca---ggcggcgg----------
A0A3S9SPV1_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3Q9HK78_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3Q9HK00_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3Q9HJ63_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A7D6TSN5_E1B19K-      gcag---cagcagcagcaggaggaagccaggcggcggcgg----------
A0A4P2SGW2_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A2H4PJ75_E1B19K-      gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A7L4WGT1_E1B19K-      --------------------aggaagcca---ggcggcgg----------
J7I6T8_E1B19K-01        gcag---cagcagcagcaggaggaagcca---ggcggcgg----------
Q71BY5_E1B19K-04        gcaa---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3S9SSS2_E1B19K-      gcaacagcagcagcagcaggaggaagcca---ggcggcgg----------
E1ARN8_E1B19K-01        gcaa---cagcagcagcaggaggaagcca---ggcggcgg----------
J9Z4N4_E1B19K-01        -------cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3Q9HLF7_E1B19K-      gcaa---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A3S9SNY0_E1B19K-      gcaa---cagcagcagcaggaggaagcca---ggcggcgg----------
A0A7D0TLU2_E1B19K-      --------ggcctcctcaaaatcacccct---ggctgcgc----------
J9Z4N4_E1B19K-02        -------cagcagcagcaggaggaagcca---ggcggcgg----------
E1ARN8_E1B19K-03        gcagcaacagcagcagcaggaggaagcca---ggcggcgg----------
E1ARN8_E1B19K-02        gcagcaacagcagcagcaggaggaagcca---ggcggcgg----------
E1ARN8_E1B19K-04        gcagcaacagcagcagcaggaggaagcca---ggcggcgg----------
J9Z4H6_E1B19K-02        gcagcagcagcagcagcaggaggaagcca---ggcggcgg----------
Q6VGV8_E1B19K-02        --agcagcagcagcagcaggaggaagcca------ggcgg----------
A0A0G2R248_E1B19K-      --agcagcagcagcagcaggaggaagcca------ggcgg----------
A0A4P2SGW2_E1B19K-      gcagcagcagcagcagcaggaggaagcca---ggcggcgg----------
J7I6T8_E1B19K-02        gcagcagcagcagcagcaggaggaagcca---ggcggcgg----------
T1UG63_E1B19K-02        gcagcagcagcagcagcaggaggaagccaggcggcggcgg----------
E1U5L6_E1B19K-03        --------agcaacagcaggaggaagcca---ggcggcgg----------
J9Z5H0_E1B19K-02        --------agcaacagcaggaggaagcca---ggcggcgg----------
E1U5L6_E1B19K-02        --------agcaacagcaggaggaagcca---ggcggcgg----------
E1U5L6_E1B19K-04        --------agcaacagcaggaggaagcca---ggcggcgg----------
D3JIR7_E1B19K-02        ggagg---agctggagcagcgggaccctg---------------------
D3JIR7_E1B19K-01        --------------------------------------------------
A0A076V686_E1B19K-      --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------aggaggagcagcagaacacta---------------------
T1UEX7_E1B19K-02        --------aggaggagcagcagaacacta---------------------
P04492_E1B19K-02        ggagaaggaggaggagcggaaccctgcgg---------------------
G1DE13_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
T1UEX7_E1B19K-01        --------------------------------------------------
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

Q7T8D8_E1B19K-03        -------tcatggctaattccacttcct---------------------c
Q6RK98_E1B19K-03        -------tcgttgccaattccagttcct---------------------c
A0A097IW62_E1B19K-      ttagaggc---agagaaccccagggcgg---------------------g
A0A0M3TH18_E1B19K-      ctggaggccgaggaggagcccagggcgg---------------------g
A0A1W5PVU4_E1B19K-      ctggaggccgaggaggagccccgggcgg---------------------g
A0A2H4CJZ0_E1B19K-      -------aggaggagaacccgagggccg---------------------g
H8PFZ1_E1B19K-01        -------aggaggagaacccgagggccg---------------------g
G0ZAH2_E1B19K-01        -------tggaggagcggctgacgcagg----------------------
F6KST6_E1B19K-01        aacatggaagagcagaaccccagagcgg---------------------g
Q695T5_E1B19K-02        ggcatggaagagaagaatccgagagcgg---------------------g
F2WTG5_E1B19K-01        ggcatggaag---agaatccgagagcgg---------------------g
Q695T5_E1B19K-01        ggcatggaagagaagaatccgagagcgg---------------------g
H9TER0_E1B19K-01        ggcatggaagagaagaatccgagagcgg---------------------g
A0A1L3INW0_E1B19K-      aacctagccgaggaggaccctcgagcgg---------------------g
P10543_E1B19K-01        --------------------------------------------cttctg
A0A6M6AEV2_E1B19K-      --------------------------------------------cttctg
A0A142G3J2_E1B19K-      --------------------------------------------cttctg
A0A7U3RVU4_E1B19K-      --------------------------------------------cttctg
A0A482EVC6_E1B19K-      gaggaggaggagaacctgagggccggtctggatcctcaaacggaattgta
A0A7U3RWV6_E1B19K-      --------------------------------------------cttctg
A0A1S6ELT2_E1B19K-      --------------------------------------------cttctg
A0A3G4W995_E1B19K-      --------------------------------------------cttctg
A0A898KBW7_E1B19K-      --------------------------------------------cttctg
A0A3G8W407_E1B19K-      --------------------------------------------cttctg
F4ZCJ8_E1B19K-01        --------------------------------------------cttctg
A0A6B9DS29_E1B19K-      --------------------------------------------cttctg
A0A8G1GLF6_E1B19K-      --------------------------------------------cttctg
B5SNR1_E1B19K-01        --------------------------------------------cttctg
P10544_E1B19K-01        --------------------------------------------cttctg
A0A482EVC6_E1B19K-      --------------------------------------------cttctg
A0A898KBR0_E1B19K-      --------------------------------------------cttctg
A0A898KBS1_E1B19K-      --------------------------------------------cttctg
W0S1G8_E1B19K-01        --------------------------------------------cttctg
A0A6M6AES6_E1B19K-      --------------------------------------------cttctg
A0A2H5AI99_E1B19K-      -----------------tctgaca--------------------------
A0MK43_E1B19K-02        -------------agaatctgagagccg---------------------g
A0A0A1EUE4_E1B19K-      -----------------tccgaca--------------------------
A0MK43_E1B19K-01        -----------------tctgaca--------------------------
A0A2H5AID8_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIL0_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIC5_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AI40_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AII9_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIN5_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIU0_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIS9_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIT6_E1B19K-      -----------------tctgaca--------------------------
Q5C8R2_E1B19K-01        -----------------tctgaca--------------------------
A0A2H5AI21_E1B19K-      -----------------tctgaca--------------------------
A0A0M5L3Y4_E1B19K-      -----------------tctgaca--------------------------
A0A0A1EUC8_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AI04_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AI72_E1B19K-      -----------------tctgaca--------------------------
A0A2H5AIL3_E1B19K-      -----------------tctgaca--------------------------
A0A0A1EUB2_E1B19K-      -----------------tctgaca--------------------------
A0A0M4NHE0_E1B19K-      gcgcagggggaggcgaaggaggaag------------cgctgcggtccgg
H9AAD9_E1B19K-01        gcgcagggggaggcgaaggaggaaa------------cgctgcggtccgg
H9AAK5_E1B19K-01        gcgcagggggaggcgaaggaggaaa------------cgctgcggtccgg
H9AAH3_E1B19K-01        gcgcagggggaggcgaaggaggaaa------------cgctgcggtccgg
F2WTJ7_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
F2WTM9_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
A0A1C8EG46_E1B19K-      gggcagggggaggagcaggagcaga------agccagcgctgcggtccgg
H9AAA8_E1B19K-01        gggcagggggaggagcaggagcaggagcagaagccagcgctgcggtccgg
H9AA76_E1B19K-01        gggcagggggaggagcaggagccgg------agccagcgctgcggtccgg
H9AAN8_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
H9AAS0_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
H9AAV3_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
H9AAY5_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
M9YVA3_E1B19K-01        gggcagggggaggagcaggagcagg------agccagcgctgcggtccgg
Q6QPF3_E1B19K-01        ---ttgctagagaactcatcg-----------------------------
Q6QPB7_E1B19K-01        ---ctgctagagaactcatcg-----------------------------
Q6QPI9_E1B19K-01        ---ctgctagagaactcatcg-----------------------------
G9G841_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
Q8UY91_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
P10406_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
Q5GFC7_E1B19K-02        ---ctgctagagaacgcctcg-----------------------------
A0A2R3WN62_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
A0A3G9CMQ4_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
Q5GFC7_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
Q5GFC8_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
Q6H1D7_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
A0A3G9JTX5_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
Q2KSM8_E1B19K-02        ---ctgctagagaacgcctcg-----------------------------
A0A2R3WNP3_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
A0A3G8W6L2_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
A0A3G9K5X3_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
Q2KSG6_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
Q2KSM8_E1B19K-01        ---ctgctagagaacgcctcg-----------------------------
A0A2R3WN16_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
Q2KSG6_E1B19K-02        ---ctgctagagaacgcctcg-----------------------------
A0A2L1F392_E1B19K-      ---ctgctagagaacgcctcg-----------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ---ctgttggagaacgcttcg-----------------------------
Q7T951_E1B19K-01        ---ctgttagagagcgcttcg-----------------------------
T1UE63_E1B19K-01        ---ctgttagagagcgcttcg-----------------------------
Q7T8D8_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
Q5UW22_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
Q8B8U7_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
Q32UI6_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
A0A7G5FB98_E1B19K-      ---ctgttagagagcgcttcg-----------------------------
A0A7G5F9T0_E1B19K-      ---ctgttagagaacgcttcg-----------------------------
J7H4R9_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
D2DM83_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
J7I6W7_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
C7SRS7_E1B19K-01        ---ctgttagagaacgcttcg-----------------------------
A0A7U3S1T6_E1B19K-      ---ctgttagagaacgcttcg-----------------------------
A0A7U3S224_E1B19K-      ---ctgttagagaacgcttcg-----------------------------
W6EIX6_E1B19K-01        ---ctgttagaggacgcttcg-----------------------------
A0A1L7NRH1_E1B19K-      ---ctgttagaggacgcttcg-----------------------------
Q3ZL02_E1B19K-01        ---ctgttagaggacgcttcg-----------------------------
T1UFS4_E1B19K-01        ---ctgttagaggacgcttcg-----------------------------
T2CI10_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A0K0PX35_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
A0A0K0PX99_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
Q3ZKW2_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
Q2KRU2_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
K7NG43_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
Q2KS85_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A0B4SJH1_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
A0A075IQ70_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
T1UIP3_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
R4HLE1_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
Q5EY83_E1B19K-01        ---ctactagaaaacgcctcg-----------------------------
Q2Y0J3_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
R4HMC6_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A897JQR0_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
I1V161_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A5P8KYF0_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
J7I6S4_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A220VZ73_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
P03248_E1B19K-02        ---ctgctagaaaacgcctcg-----------------------------
Q6RK98_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
J7I6Q4_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A8B0LCV0_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
J7ID56_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
I6LEP5_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A6M6AA96_E1B19K-      ---ctgatagaaaacgcctcg-----------------------------
A0A8B0LD36_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
A0A8B0LBX6_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
A0A8B0L9Y2_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
R4HLJ6_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
R4HLA0_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
Q2KSL3_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
A0A5J6CTQ0_E1B19K-      ---ctgctagaaaacgcctcg-----------------------------
I6LES1_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
T1UF50_E1B19K-01        ---ctgctagaaaacgcctcg-----------------------------
Q7T8D8_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
Q32UI6_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
A0A7G5FB98_E1B19K-      gaacagcaagaggacaacccgagagccg---------------------g
J7I6W7_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
W6EIX6_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
Q3ZL02_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
T1UFS4_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
T1UE63_E1B19K-02        gaacagcaagaggacaacccgagagccg---------------------g
T1UJX4_E1B19K-02        gaacagcaagaggacaatccgagagccg---------------------g
T2CI10_E1B19K-02        gagcaccaagaggacaatccgagagtcg---------------------g
Q2Y0J3_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q5EY83_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
J7ID56_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
I6LEP5_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q2KSL3_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
T1UF50_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
R4HLE1_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
P03248_E1B19K-03        gagcagcaggaggacaatccgagagccg---------------------g
Q6RK98_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
J7I6Q4_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
R4HMC6_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
I1V161_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
A0A5P8KYF0_E1B19K-      gagcagcaggaggacaatccgagagccg---------------------g
J7I6S4_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
A0A897JQR0_E1B19K-      gagcagcaggaggacaatccgagagccg---------------------g
K7NG43_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q3ZKW2_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q2KRU2_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
T1UIP3_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
Q2KS85_E1B19K-02        gagcagcaggaggacaatccgagagccg---------------------g
A0A0B4SJH1_E1B19K-      gagcagcaggaggacaatccgagagccg---------------------g
A0A075IQ70_E1B19K-      gagcagcaggaggacaatccgagagccg---------------------g
M9YVF6_E1B19K-01        ------------gagaacccgagggcag---------------------g
A0A0M3TH31_E1B19K-      -------agaacgagaacccgagggccg---------------------g
M9YXY5_E1B19K-01        -------agaacgagaacccgagggccg---------------------g
Q71BY5_E1B19K-01        -------------------------------------------------t
Q71BY5_E1B19K-02        -------------------------------------------------t
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        -------a------ggagatgaggtccg---------------------g
A0A0M4N3Z1_E1B19K-      -------aagagggggaaatgaggtccg---------------------g
Q8B6X5_E1B19K-01        -------aagagggggaaatgaggtccg---------------------g
B9A5L5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UGY3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A1P7YYY5_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YWY2_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YWR9_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YXN8_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P8C849_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
B9A5A7_E1B19K-01        -------tggacaagaacccgaggagcg---------------------g
T1UG22_E1B19K-01        -------tggacaagaacccgaggagcg---------------------g
M0QVG6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
X4YVU5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QUS9_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QU02_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A291B0H2_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QV87_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UKV6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
W8VNG2_E1B19K-01        -------tggacgacaacccgaggagcg---------------------g
F8UFP5_E1B19K-01        -------tggacgacaacccgaggagcg---------------------g
T1UGT5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UGX3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
W8CZB0_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
G3CK71_E1B19K-01        -------tgtacgagaacccgaggagcg---------------------g
M0QTS5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QV08_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
G9JUV5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
G1FC01_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A0G2UY10_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
A0A1J0MS84_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QUJ3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
H0PPE7_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UKP8_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UHQ8_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
Q4KSL0_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UHG3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A384ZUF2_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QUN2_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E1CIM6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E1AI10_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
Q9YL99_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
K7ZLN6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E1CIR1_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A1Y1BXT7_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
A0A8F5PHF8_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
T1UHH6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QVT4_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1ULJ8_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E9P585_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
D4N3H6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
C4P207_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1ULP4_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A384ZUM9_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
B9A5Q1_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QUB4_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QVK6_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A3G8WIY5_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
X4Y9D2_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UHL7_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A075TSZ1_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
F1DT57_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A3Q9FFS0_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QUF3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E5RWD9_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E5RWL1_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
B6DU90_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
B9A5T7_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A7R6T9I9_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
B6C6W8_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
B9A681_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A1Y1BYF1_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
T1UHZ2_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
B2VQE3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QU76_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QVC7_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QU41_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
A0A097I4T0_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
A0A3S6PYX7_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
C5HDR2_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
D3GBW3_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UK99_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
G1FBW4_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UKQ0_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QVP5_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
H5T740_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QUW8_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
E1CIJ0_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UGU0_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
M0QV47_E1B19K-01        -------tggacgagaacccgaggagcg---------------------g
T1UGY3_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A1P8C849_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YYY5_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
T1UG22_E1B19K-02        -------tggacaagaacccgaggagcg---------------------g
A0A1P7YWR9_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YXN8_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
A0A1P7YWY2_E1B19K-      -------tggacaagaacccgaggagcg---------------------g
M0QU02_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QUS9_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QV47_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UGU0_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QUW8_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QVP5_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
G1FBW4_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UKQ0_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
F8UFP5_E1B19K-02        -------tggacgacaacccgaggagcg---------------------g
T1UGT5_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A384ZUM9_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QV87_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UKV6_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A3S6PYX7_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
C5HDR2_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A097I4T0_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
T1UHZ2_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A3Q9FFS0_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QVC7_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QU76_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QU41_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QUJ3_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QUF3_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QTS5_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QV08_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UGX3_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
G1FC01_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
G3CK71_E1B19K-02        -------tgtacgagaacccgaggagcg---------------------g
A0A0G2UY10_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
T1ULP4_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
F1DT57_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UHQ8_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UHL7_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A075TSZ1_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
C4P207_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A8F5PHF8_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
T1UHG3_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A384ZUF2_E1B19K-      -------tggacgagaacccgaggagcg---------------------g
M0QUN2_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
E1AI10_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QVK6_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UHH6_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UK99_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QVG6_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1UKP8_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
W8CZB0_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QUB4_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
M0QVT4_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
E9P585_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
T1ULJ8_E1B19K-02        -------tggacgagaacccgaggagcg---------------------g
A0A7L4WIC2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
Q6WQ37_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
Q6VGV8_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A0G2R248_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7D0TN91_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A5K6WAR5_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SND6_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SNH4_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A513TZR1_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7L4WK62_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A291P1B2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
T1UG63_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HJZ5_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A8F9W8V2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SP19_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A6M4W5T4_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7L4WG90_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A516UYM9_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
J9Z4H6_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A1U9ALK7_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A6M5E4Y6_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
P03247_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3G8W3H5_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
E1U5L6_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A516UYI9_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HJ54_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
J9Z5H0_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7L4WJT1_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7L4WIG2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SPV1_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HK78_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HK00_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HJ63_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7D6TSN5_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A4P2SGW2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A2H4PJ75_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7L4WGT1_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
J7I6T8_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
Q71BY5_E1B19K-04        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SSS2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
E1ARN8_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
J9Z4N4_E1B19K-01        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3Q9HLF7_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A3S9SNY0_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A7D0TLU2_E1B19K-      cggggggaggagcagagcttattgtacttgcaatctg------------g
J9Z4N4_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1ARN8_E1B19K-03        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1ARN8_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1ARN8_E1B19K-04        cggcggcaggagcagagcccatggaacccgagagccg------------g
J9Z4H6_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
Q6VGV8_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A0G2R248_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
A0A4P2SGW2_E1B19K-      cggcggcaggagcagagcccatggaacccgagagccg------------g
J7I6T8_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
T1UG63_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1U5L6_E1B19K-03        cggcggcaggagcagagcccatggaacccgagagccg------------g
J9Z5H0_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1U5L6_E1B19K-02        cggcggcaggagcagagcccatggaacccgagagccg------------g
E1U5L6_E1B19K-04        cggcggcaggagcagagcccatggaacccgagagccg------------g
D3JIR7_E1B19K-02        ----cggcggagaagtgaacatggaacaacaggtgcaagaaggccatgca
D3JIR7_E1B19K-01        -----------acagtatacctctaaaaac-------------------a
A0A076V686_E1B19K-      -----------acagcatacctctagaaac-------------------a
A0A5H2QAX5_E1B19K-      ----cgacggaggagtaaacatggaaccacaggtgcaagaaggccatgaa
T1UEX7_E1B19K-02        ----cgacggaggagtaaacatggaaccacaggtgcaagaaggccatgaa
P04492_E1B19K-02        ----tggtggagaagtaaacatggaacaacaggtgcaagaaggccatgta
G1DE13_E1B19K-01        -----------gcagtatacctctaaaaac-------------------a
A0A5H2QAX5_E1B19K-      -----------gcagtatacctctaaaaac-------------------a
D0Z5R9_E1B19K-01        -----------gcagtatacctctaaaaac-------------------a
T1UEX7_E1B19K-01        -----------gcagtatacctctaaaaac-------------------a
A0A3G8WH01_E1B19K-      -----------gcagtatacctctaagaac-------------------a
P04492_E1B19K-01        -----------gcagtatacctctaaaaac-------------------a

Q7T8D8_E1B19K-03        taataacccttctaccctgactcaggacaagttacttgtccttttggccc
Q6RK98_E1B19K-03        taataacccttcaaccctggctgaggacaagctacttgttctgttggctc
A0A097IW62_E1B19K-      catggatcccccgag---------cgagaattaa----------------
A0A0M3TH18_E1B19K-      gacggatcccccgag---------cgagacttga----------------
A0A1W5PVU4_E1B19K-      aatggatcccccgag---------cgagacttga----------------
A0A2H4CJZ0_E1B19K-      cctggacccttc------------ggcggaatag----------------
H8PFZ1_E1B19K-01        cctggaccctcc------------ggcggaatag----------------
G0ZAH2_E1B19K-01        --tgcagcgggagttggaagagagggagagggag----------------
F6KST6_E1B19K-01        gctggaccctccagt---------ggaggcgtag----------------
Q695T5_E1B19K-02        gctggaccctccggc---------ggaggagtaggggggataccggaccc
F2WTG5_E1B19K-01        gctggaccctccagc---------ggaggagtag----------------
Q695T5_E1B19K-01        gctggaccctccggc---------ggaggagtag----------------
H9TER0_E1B19K-01        gctggaccctccggc---------ggaggagtag----------------
A0A1L3INW0_E1B19K-      gctggaccctcc------------ggaggaggag---------gtggact
P10543_E1B19K-01        ccagaactt----------------------------------ccagct-
A0A6M6AEV2_E1B19K-      ccagaactt----------------------------------ccagct-
A0A142G3J2_E1B19K-      ccagaactt----------------------------------ccagct-
A0A7U3RVU4_E1B19K-      ccagaactt----------------------------------ccagct-
A0A482EVC6_E1B19K-      actgaacctgacccc---------gaagagggta---------ctagca-
A0A7U3RWV6_E1B19K-      ccagaactt----------------------------------ccagct-
A0A1S6ELT2_E1B19K-      ccagaactt----------------------------------ccagct-
A0A3G4W995_E1B19K-      ccagaactt----------------------------------ccagct-
A0A898KBW7_E1B19K-      ccagaactt----------------------------------ccagct-
A0A3G8W407_E1B19K-      ccagaactt----------------------------------ccagct-
F4ZCJ8_E1B19K-01        ccagaactt----------------------------------ccagct-
A0A6B9DS29_E1B19K-      ccagaactt----------------------------------ccagct-
A0A8G1GLF6_E1B19K-      ccagaactt----------------------------------ccagct-
B5SNR1_E1B19K-01        ccagaactt----------------------------------ccagct-
P10544_E1B19K-01        ccagaactt----------------------------------ccagct-
A0A482EVC6_E1B19K-      ccagaactt----------------------------------ccagct-
A0A898KBR0_E1B19K-      ccagaactt----------------------------------ccagct-
A0A898KBS1_E1B19K-      ccagaactt----------------------------------ccagct-
W0S1G8_E1B19K-01        ccagaactt----------------------------------ccagct-
A0A6M6AES6_E1B19K-      ccagaactt----------------------------------ccagct-
A0A2H5AI99_E1B19K-      ----aaacttccaa------------------------------------
A0MK43_E1B19K-02        cctggaccctccagtggaagactaggtgctgagg---------atgatcc
A0A0A1EUE4_E1B19K-      ----aaacttccag------------------------------------
A0MK43_E1B19K-01        ----aaacttccag------------------------------------
A0A2H5AID8_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIL0_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIC5_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AI40_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AII9_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIN5_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIU0_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIS9_E1B19K-      ----aaacttccag------------------------------------
A0A2H5AIT6_E1B19K-      ----aaacttccag------------------------------------
Q5C8R2_E1B19K-01        ----gaacttccaa------------------------------------
A0A2H5AI21_E1B19K-      ----gaacttccaa------------------------------------
A0A0M5L3Y4_E1B19K-      ----gaacttccaa------------------------------------
A0A0A1EUC8_E1B19K-      ----gaacttccaa------------------------------------
A0A2H5AI04_E1B19K-      ----gaacttccaa------------------------------------
A0A2H5AI72_E1B19K-      ----gaacttccaa------------------------------------
A0A2H5AIL3_E1B19K-      ----gaacttccaa------------------------------------
A0A0A1EUB2_E1B19K-      ----gaacttccaa------------------------------------
A0A0M4NHE0_E1B19K-      cctggaccctcc------------ggtggagg------------aggact
H9AAD9_E1B19K-01        cctggaccctcc------------ggtggagg------------agaact
H9AAK5_E1B19K-01        cctggaccctcc------------ggtggagg------------agaact
H9AAH3_E1B19K-01        cctgaaccctcc------------ggtggagg------------agaact
F2WTJ7_E1B19K-01        cctggaccctcc------------ggaggagaag---------gaggatt
F2WTM9_E1B19K-01        cctggaccctcc------------ggaggagaag---------gaggatt
A0A1C8EG46_E1B19K-      cctgggccctcc------------ggaggaga---------------att
H9AAA8_E1B19K-01        cttggaccctcc------------ggaggaga---------------att
H9AA76_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
H9AAN8_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
H9AAS0_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
H9AAV3_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
H9AAY5_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
M9YVA3_E1B19K-01        cctggaccctcc------------ggaggaga---------------att
Q6QPF3_E1B19K-01        ------------------------gagggagtct---------cttacct
Q6QPB7_E1B19K-01        ------------------------gagggggtct---------cttacct
Q6QPI9_E1B19K-01        ------------------------gagggagtct---------cttacct
G9G841_E1B19K-01        ------------------------aacggagtct---------ctcacct
Q8UY91_E1B19K-01        ------------------------aacggagtct---------cttacct
P10406_E1B19K-01        ------------------------aacggagtct---------ctcacct
Q5GFC7_E1B19K-02        ------------------------aacggagtct---------cttacct
A0A2R3WN62_E1B19K-      ------------------------aacggagtct---------cttacct
A0A3G9CMQ4_E1B19K-      ------------------------aacggagtct---------cttacct
Q5GFC7_E1B19K-01        ------------------------aacggagtct---------cttacct
Q5GFC8_E1B19K-01        ------------------------aacggagtct---------cttacct
Q6H1D7_E1B19K-01        ------------------------aacggagtct---------cttacct
A0A3G9JTX5_E1B19K-      ------------------------aacggagttt---------cttacct
Q2KSM8_E1B19K-02        ------------------------aacggagttt---------cttacct
A0A2R3WNP3_E1B19K-      ------------------------aacggagttt---------cttacct
A0A3G8W6L2_E1B19K-      ------------------------aacggagttt---------cttacct
A0A3G9K5X3_E1B19K-      ------------------------aacggagttt---------cttacct
Q2KSG6_E1B19K-01        ------------------------aacggagttt---------cttacct
Q2KSM8_E1B19K-01        ------------------------aacggagttt---------cttacct
A0A2R3WN16_E1B19K-      ------------------------aacggagttt---------cttacct
Q2KSG6_E1B19K-02        ------------------------aacggagttt---------cttacct
A0A2L1F392_E1B19K-      ------------------------aacggagttt---------cttacct
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ------------------------gacggagtct---------ccggttt
Q7T951_E1B19K-01        ------------------------gacggagtct---------ccggttt
T1UE63_E1B19K-01        ------------------------gacggagtct---------ccggttt
Q7T8D8_E1B19K-01        ------------------------gacggagtct---------ccggttt
Q5UW22_E1B19K-01        ------------------------gacggagtct---------ccggttt
Q8B8U7_E1B19K-01        ------------------------gacggagtct---------ccggttt
Q32UI6_E1B19K-01        ------------------------gacggagtct---------ccggttt
A0A7G5FB98_E1B19K-      ------------------------gacggagtct---------ccggttt
A0A7G5F9T0_E1B19K-      ------------------------gacggagtct---------ccggttt
J7H4R9_E1B19K-01        ------------------------gacggagtct---------ccggttt
D2DM83_E1B19K-01        ------------------------gacggagtct---------ccggttt
J7I6W7_E1B19K-01        ------------------------gacggagtct---------ccggttt
C7SRS7_E1B19K-01        ------------------------gacggagtct---------ccggttt
A0A7U3S1T6_E1B19K-      ------------------------gacggagtct---------ccggttt
A0A7U3S224_E1B19K-      ------------------------gacggagtct---------ccggttt
W6EIX6_E1B19K-01        ------------------------gacggagtct---------ccggttt
A0A1L7NRH1_E1B19K-      ------------------------gacggagtct---------ccggttt
Q3ZL02_E1B19K-01        ------------------------gacggagtct---------ccggttt
T1UFS4_E1B19K-01        ------------------------gacggagtct---------ccggttt
T2CI10_E1B19K-01        ------------------------gacggagtct---------ctggtct
A0A0K0PX35_E1B19K-      ------------------------gacggagtct---------ctggcct
A0A0K0PX99_E1B19K-      ------------------------gacggagtct---------ctggcct
Q3ZKW2_E1B19K-01        ------------------------gacggagtct---------ctggctt
Q2KRU2_E1B19K-01        ------------------------gacggagtct---------ctggctt
K7NG43_E1B19K-01        ------------------------gacggagtct---------ctggctt
Q2KS85_E1B19K-01        ------------------------gacggagtct---------ctggctt
A0A0B4SJH1_E1B19K-      ------------------------gacggagtct---------ctggctt
A0A075IQ70_E1B19K-      ------------------------gacggagtct---------ctggctt
T1UIP3_E1B19K-01        ------------------------gacggagtct---------ctggctt
R4HLE1_E1B19K-01        ------------------------gacggagtct---------ctggcct
Q5EY83_E1B19K-01        ------------------------gacggagtct---------ctggcct
Q2Y0J3_E1B19K-01        ------------------------gacggagtct---------ctggcct
R4HMC6_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A897JQR0_E1B19K-      ------------------------gacggagtct---------ctggcct
I1V161_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A5P8KYF0_E1B19K-      ------------------------gacggagtct---------ctggcct
J7I6S4_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A220VZ73_E1B19K-      ------------------------gacggagtct---------ctggcct
P03248_E1B19K-02        ------------------------gacggagtct---------ctggcct
Q6RK98_E1B19K-01        ------------------------gacggagtct---------ctggcct
J7I6Q4_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A8B0LCV0_E1B19K-      ------------------------gacggagtct---------ctggttt
J7ID56_E1B19K-01        ------------------------gacggagtct---------ctggcct
I6LEP5_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A6M6AA96_E1B19K-      ------------------------gacggagtct---------ctggcct
A0A8B0LD36_E1B19K-      ------------------------gacggagtct---------ctggcct
A0A8B0LBX6_E1B19K-      ------------------------gacggagtct---------ctggcct
A0A8B0L9Y2_E1B19K-      ------------------------gacggagtct---------ctggcct
R4HLJ6_E1B19K-01        ------------------------gacggagtct---------ctggcct
R4HLA0_E1B19K-01        ------------------------gacggagtct---------ctggcct
Q2KSL3_E1B19K-01        ------------------------gacggagtct---------ctggcct
A0A5J6CTQ0_E1B19K-      ------------------------gacggagtct---------ctggcct
I6LES1_E1B19K-01        ------------------------gacggagtct---------ctggcct
T1UF50_E1B19K-01        ------------------------gacggagtct---------ctggcct
Q7T8D8_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
Q32UI6_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
A0A7G5FB98_E1B19K-      cctggaccctccagtggagga---ggcggagtag---------ctgactt
J7I6W7_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
W6EIX6_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
Q3ZL02_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
T1UFS4_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
T1UE63_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
T1UJX4_E1B19K-02        cctggaccctccagtggagga---ggcggagtag---------ctgactt
T2CI10_E1B19K-02        cctggaccctccggtggaggaggcggaggagtag---------ctgactt
Q2Y0J3_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q5EY83_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
J7ID56_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
I6LEP5_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q2KSL3_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
T1UF50_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
R4HLE1_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
P03248_E1B19K-03        cctggaccctccggt---------ggaggagtag---------ctgacct
Q6RK98_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
J7I6Q4_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
R4HMC6_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
I1V161_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
A0A5P8KYF0_E1B19K-      cctggaccctccggt---------ggaggagtag---------ctgacct
J7I6S4_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
A0A897JQR0_E1B19K-      cctggaccctccggt---------ggaggagtag---------ctgacct
K7NG43_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q3ZKW2_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q2KRU2_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgactt
T1UIP3_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
Q2KS85_E1B19K-02        cctggaccctccggt---------ggaggagtag---------ctgacct
A0A0B4SJH1_E1B19K-      cctggaccctccggt---------ggaggagtag---------ctgacct
A0A075IQ70_E1B19K-      cctggaccctccggt---------ggaggagtag---------ctgacct
M9YVF6_E1B19K-01        cgtggaccctcctct---------ggaatag-------------------
A0A0M3TH31_E1B19K-      cgtggaccctcctct---------ggaatag-------------------
M9YXY5_E1B19K-01        cgtggaccctcctct---------ggaatag-------------------
Q71BY5_E1B19K-01        tcctgactctgtaat---------gttggcggcg---------caggaag
Q71BY5_E1B19K-02        tcctgactctgtaat---------gttggcggcg---------caggaag
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        cctggaccctccaac---------gga------------------gaact
A0A0M4N3Z1_E1B19K-      cctggaccctccaac---------gga------------------gaact
Q8B6X5_E1B19K-01        cctggaccctccaac---------gga------------------gaact
B9A5L5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGY3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YYY5_E1B19K-      cctggaccctccgtt---------ggaagaggag---------ctggatt
A0A1P7YWY2_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YWR9_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YXN8_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P8C849_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
B9A5A7_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UG22_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVG6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
X4YVU5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUS9_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU02_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A291B0H2_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV87_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKV6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ttggatt
W8VNG2_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
F8UFP5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGT5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGX3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
W8CZB0_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
G3CK71_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QTS5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV08_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
G9JUV5_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
G1FC01_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A0G2UY10_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1J0MS84_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUJ3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
H0PPE7_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKP8_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHQ8_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
Q4KSL0_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHG3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A384ZUF2_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUN2_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E1CIM6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E1AI10_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
Q9YL99_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
K7ZLN6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E1CIR1_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1Y1BXT7_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A8F5PHF8_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHH6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVT4_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1ULJ8_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E9P585_E1B19K-01        cctggaccctccgtt---------ggaagaggag---------ctggatt
D4N3H6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
C4P207_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1ULP4_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A384ZUM9_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
B9A5Q1_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUB4_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVK6_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A3G8WIY5_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
X4Y9D2_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHL7_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A075TSZ1_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
F1DT57_E1B19K-01        tctggaccctccgtc---------ggaagaggag---------ttggatt
A0A3Q9FFS0_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUF3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E5RWD9_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E5RWL1_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
B6DU90_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
B9A5T7_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctgaatt
A0A7R6T9I9_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctgaatt
B6C6W8_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctgaatt
B9A681_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctgaatt
A0A1Y1BYF1_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctgaatt
T1UHZ2_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctgaatt
B2VQE3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU76_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVC7_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU41_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A097I4T0_E1B19K-      cctggaccctccgcc---------ggaagaggag---------ctggatt
A0A3S6PYX7_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
C5HDR2_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
D3GBW3_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UK99_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
G1FBW4_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKQ0_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVP5_E1B19K-01        tctggaccctccgtc---------ggaagaggag---------ctggatt
H5T740_E1B19K-01        tctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUW8_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
E1CIJ0_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGU0_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV47_E1B19K-01        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGY3_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P8C849_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YYY5_E1B19K-      cctggaccctccgtt---------ggaagaggag---------ctggatt
T1UG22_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YWR9_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YXN8_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A1P7YWY2_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU02_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUS9_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV47_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGU0_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUW8_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVP5_E1B19K-02        tctggaccctccgtc---------ggaagaggag---------ctggatt
G1FBW4_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKQ0_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
F8UFP5_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGT5_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A384ZUM9_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV87_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKV6_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ttggatt
A0A3S6PYX7_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
C5HDR2_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A097I4T0_E1B19K-      cctggaccctccgcc---------ggaagaggag---------ctggatt
T1UHZ2_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctgaatt
A0A3Q9FFS0_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVC7_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU76_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QU41_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUJ3_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUF3_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QTS5_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QV08_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UGX3_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
G1FC01_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
G3CK71_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A0G2UY10_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
T1ULP4_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
F1DT57_E1B19K-02        tctggaccctccgtc---------ggaagaggag---------ttggatt
T1UHQ8_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHL7_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A075TSZ1_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
C4P207_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A8F5PHF8_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHG3_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A384ZUF2_E1B19K-      cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUN2_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
E1AI10_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVK6_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UHH6_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UK99_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVG6_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
T1UKP8_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
W8CZB0_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QUB4_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
M0QVT4_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
E9P585_E1B19K-02        cctggaccctccgtt---------ggaagaggag---------ctggatt
T1ULJ8_E1B19K-02        cctggaccctccgtc---------ggaagaggag---------ctggatt
A0A7L4WIC2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
Q6WQ37_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
Q6VGV8_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A0G2R248_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7D0TN91_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A5K6WAR5_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3S9SND6_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3S9SNH4_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A513TZR1_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7L4WK62_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A291P1B2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
T1UG63_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A3Q9HJZ5_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A8F9W8V2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3S9SP19_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A6M4W5T4_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7L4WG90_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A516UYM9_E1B19K-      cctggaccctcgg-----------gaatg---------------------
J9Z4H6_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A1U9ALK7_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A6M5E4Y6_E1B19K-      cctggaccctcgg-----------gaatg---------------------
P03247_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A3G8W3H5_E1B19K-      cctggaccctcgg-----------gaatg---------------------
E1U5L6_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A516UYI9_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3Q9HJ54_E1B19K-      cctggaccctcgg-----------gaatg---------------------
J9Z5H0_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A7L4WJT1_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7L4WIG2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3S9SPV1_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3Q9HK78_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3Q9HK00_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3Q9HJ63_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7D6TSN5_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A4P2SGW2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A2H4PJ75_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7L4WGT1_E1B19K-      cctggaccctcgg-----------gaatg---------------------
J7I6T8_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
Q71BY5_E1B19K-04        cctggaccctcgg-----------gaatg---------------------
A0A3S9SSS2_E1B19K-      cctggaccctcgg-----------gaatg---------------------
E1ARN8_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
J9Z4N4_E1B19K-01        cctggaccctcgg-----------gaatg---------------------
A0A3Q9HLF7_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A3S9SNY0_E1B19K-      cctggaccctcgg-----------gaatg---------------------
A0A7D0TLU2_E1B19K-      cctggaccctcgg-----------aagtgccacc---------ttgtgca
J9Z4N4_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
E1ARN8_E1B19K-03        cctggaccctcgg-----------gaatg-aatg---------ttgt---
E1ARN8_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
E1ARN8_E1B19K-04        cctggaccctcgg-----------gaatg-aatg---------ttgt---
J9Z4H6_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
Q6VGV8_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
A0A0G2R248_E1B19K-      cctggaccctcgg-----------gaatg-aatg---------ttgtaca
A0A4P2SGW2_E1B19K-      cctggaccctcgg-----------gaatg-aatg---------ttgtaca
J7I6T8_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
T1UG63_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
E1U5L6_E1B19K-03        cctggaccctcgg-----------gaatg-aatg---------ttgtac-
J9Z5H0_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
E1U5L6_E1B19K-02        cctggaccctcgg-----------gaatg-aatg---------ttgtaca
E1U5L6_E1B19K-04        cctggaccctcgg-----------gaatg-aatg---------ttgt---
D3JIR7_E1B19K-02        cttgaccctgagg-----------aagggcccag---------ctgtgca
D3JIR7_E1B19K-01        cttcag---------------------------g---------tt-----
A0A076V686_E1B19K-      cctcag---------------------------g---------tt-----
A0A5H2QAX5_E1B19K-      cctgaccccgacg-----------aagggcctag---------ttgtgca
T1UEX7_E1B19K-02        cctgaccccgacg-----------aagggcctag---------ttgtgca
P04492_E1B19K-02        cttgagcgtggcg-----------aagggcctag---------ttgcgca
G1DE13_E1B19K-01        cttcag---------------------------g---------tt-----
A0A5H2QAX5_E1B19K-      cttcag---------------------------g---------tt-----
D0Z5R9_E1B19K-01        cttcag---------------------------g---------tt-----
T1UEX7_E1B19K-01        cttcag---------------------------g---------tt-----
A0A3G8WH01_E1B19K-      cttcag---------------------------g---------tt-----
P04492_E1B19K-01        cttcag---------------------------g---------tt-----

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        ttttcctgagttggctttgggggcggtggggggcgcttctgtggtacgtg
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      ag------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-02        tgaagaggggactagtgggggtgctaggaaaaagcaaaaaactgagcctg
A0A0A1EUE4_E1B19K-      --------------------------------------------------
A0MK43_E1B19K-01        --------------------------------------------------
A0A2H5AID8_E1B19K-      --------------------------------------------------
A0A2H5AIL0_E1B19K-      --------------------------------------------------
A0A2H5AIC5_E1B19K-      --------------------------------------------------
A0A2H5AI40_E1B19K-      --------------------------------------------------
A0A2H5AII9_E1B19K-      --------------------------------------------------
A0A2H5AIN5_E1B19K-      --------------------------------------------------
A0A2H5AIU0_E1B19K-      --------------------------------------------------
A0A2H5AIS9_E1B19K-      --------------------------------------------------
A0A2H5AIT6_E1B19K-      --------------------------------------------------
Q5C8R2_E1B19K-01        --------------------------------------------------
A0A2H5AI21_E1B19K-      --------------------------------------------------
A0A0M5L3Y4_E1B19K-      --------------------------------------------------
A0A0A1EUC8_E1B19K-      --------------------------------------------------
A0A2H5AI04_E1B19K-      --------------------------------------------------
A0A2H5AI72_E1B19K-      --------------------------------------------------
A0A2H5AIL3_E1B19K-      --------------------------------------------------
A0A0A1EUB2_E1B19K-      --------------------------------------------------
A0A0M4NHE0_E1B19K-      ag------------------------------------------------
H9AAD9_E1B19K-01        ag------------------------------------------------
H9AAK5_E1B19K-01        ag------------------------------------------------
H9AAH3_E1B19K-01        ag------------------------------------------------
F2WTJ7_E1B19K-01        aa------------------------------------------------
F2WTM9_E1B19K-01        aa------------------------------------------------
A0A1C8EG46_E1B19K-      aa------------------------------------------------
H9AAA8_E1B19K-01        aa------------------------------------------------
H9AA76_E1B19K-01        aa------------------------------------------------
H9AAN8_E1B19K-01        aa------------------------------------------------
H9AAS0_E1B19K-01        aa------------------------------------------------
H9AAV3_E1B19K-01        aa------------------------------------------------
H9AAY5_E1B19K-01        aa------------------------------------------------
M9YVA3_E1B19K-01        aa------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
Q32UI6_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
A0A7G5FB98_E1B19K-      gtctcctgaactgcaacgggtgcttactggatttac--------------
J7I6W7_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
W6EIX6_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
Q3ZL02_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
T1UFS4_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
T1UE63_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
T1UJX4_E1B19K-02        gtctcctgaactgcaacgggtgcttactggatctac--------------
T2CI10_E1B19K-02        gtttcctgaactgcgacgggtgcttactagatctac--------------
Q2Y0J3_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q5EY83_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
J7ID56_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
I6LEP5_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q2KSL3_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
T1UF50_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
R4HLE1_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
P03248_E1B19K-03        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q6RK98_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
J7I6Q4_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
R4HMC6_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
I1V161_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
A0A5P8KYF0_E1B19K-      gtttcctgaactgcgacgggtgcttactaggtctac--------------
J7I6S4_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
A0A897JQR0_E1B19K-      gtttcctgaactgcgacgggtgcttactaggtctac--------------
K7NG43_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q3ZKW2_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q2KRU2_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
T1UIP3_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
Q2KS85_E1B19K-02        gtttcctgaactgcgacgggtgcttactaggtctac--------------
A0A0B4SJH1_E1B19K-      gtttcctgaactgcgacgggtgcttactaggtctac--------------
A0A075IQ70_E1B19K-      gtttcctgaactgcgacgggtgcttactaggtctac--------------
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        gg------------------------------------------------
Q71BY5_E1B19K-02        gg------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        ga------------------------------------------------
A0A0M4N3Z1_E1B19K-      ga------------------------------------------------
Q8B6X5_E1B19K-01        ga------------------------------------------------
B9A5L5_E1B19K-01        aa------------------------------------------------
T1UGY3_E1B19K-01        aa------------------------------------------------
A0A1P7YYY5_E1B19K-      aa------------------------------------------------
A0A1P7YWY2_E1B19K-      aa------------------------------------------------
A0A1P7YWR9_E1B19K-      aa------------------------------------------------
A0A1P7YXN8_E1B19K-      aa------------------------------------------------
A0A1P8C849_E1B19K-      aa------------------------------------------------
B9A5A7_E1B19K-01        aa------------------------------------------------
T1UG22_E1B19K-01        aa------------------------------------------------
M0QVG6_E1B19K-01        ga------------------------------------------------
X4YVU5_E1B19K-01        ga------------------------------------------------
M0QUS9_E1B19K-01        ga------------------------------------------------
M0QU02_E1B19K-01        ga------------------------------------------------
A0A291B0H2_E1B19K-      ga------------------------------------------------
M0QV87_E1B19K-01        ga------------------------------------------------
T1UKV6_E1B19K-01        ga------------------------------------------------
W8VNG2_E1B19K-01        ga------------------------------------------------
F8UFP5_E1B19K-01        ga------------------------------------------------
T1UGT5_E1B19K-01        ga------------------------------------------------
T1UGX3_E1B19K-01        ga------------------------------------------------
W8CZB0_E1B19K-01        ga------------------------------------------------
G3CK71_E1B19K-01        ga------------------------------------------------
M0QTS5_E1B19K-01        ga------------------------------------------------
M0QV08_E1B19K-01        ga------------------------------------------------
G9JUV5_E1B19K-01        ga------------------------------------------------
G1FC01_E1B19K-01        ga------------------------------------------------
A0A0G2UY10_E1B19K-      ga------------------------------------------------
A0A1J0MS84_E1B19K-      ga------------------------------------------------
M0QUJ3_E1B19K-01        ga------------------------------------------------
H0PPE7_E1B19K-01        ga------------------------------------------------
T1UKP8_E1B19K-01        ga------------------------------------------------
T1UHQ8_E1B19K-01        ga------------------------------------------------
Q4KSL0_E1B19K-01        ga------------------------------------------------
T1UHG3_E1B19K-01        ga------------------------------------------------
A0A384ZUF2_E1B19K-      ga------------------------------------------------
M0QUN2_E1B19K-01        ga------------------------------------------------
E1CIM6_E1B19K-01        ga------------------------------------------------
E1AI10_E1B19K-01        ga------------------------------------------------
Q9YL99_E1B19K-01        ga------------------------------------------------
K7ZLN6_E1B19K-01        ga------------------------------------------------
E1CIR1_E1B19K-01        ga------------------------------------------------
A0A1Y1BXT7_E1B19K-      ga------------------------------------------------
A0A8F5PHF8_E1B19K-      ga------------------------------------------------
T1UHH6_E1B19K-01        ga------------------------------------------------
M0QVT4_E1B19K-01        ga------------------------------------------------
T1ULJ8_E1B19K-01        ga------------------------------------------------
E9P585_E1B19K-01        ga------------------------------------------------
D4N3H6_E1B19K-01        ga------------------------------------------------
C4P207_E1B19K-01        ga------------------------------------------------
T1ULP4_E1B19K-01        ga------------------------------------------------
A0A384ZUM9_E1B19K-      ga------------------------------------------------
B9A5Q1_E1B19K-01        ga------------------------------------------------
M0QUB4_E1B19K-01        ga------------------------------------------------
M0QVK6_E1B19K-01        ga------------------------------------------------
A0A3G8WIY5_E1B19K-      ga------------------------------------------------
X4Y9D2_E1B19K-01        ga------------------------------------------------
T1UHL7_E1B19K-01        ga------------------------------------------------
A0A075TSZ1_E1B19K-      ga------------------------------------------------
F1DT57_E1B19K-01        ga------------------------------------------------
A0A3Q9FFS0_E1B19K-      ga------------------------------------------------
M0QUF3_E1B19K-01        ga------------------------------------------------
E5RWD9_E1B19K-01        ga------------------------------------------------
E5RWL1_E1B19K-01        ga------------------------------------------------
B6DU90_E1B19K-01        ga------------------------------------------------
B9A5T7_E1B19K-01        ga------------------------------------------------
A0A7R6T9I9_E1B19K-      ga------------------------------------------------
B6C6W8_E1B19K-01        ga------------------------------------------------
B9A681_E1B19K-01        ga------------------------------------------------
A0A1Y1BYF1_E1B19K-      ga------------------------------------------------
T1UHZ2_E1B19K-01        ga------------------------------------------------
B2VQE3_E1B19K-01        ga------------------------------------------------
M0QU76_E1B19K-01        ga------------------------------------------------
M0QVC7_E1B19K-01        ga------------------------------------------------
M0QU41_E1B19K-01        ga------------------------------------------------
A0A097I4T0_E1B19K-      ga------------------------------------------------
A0A3S6PYX7_E1B19K-      ga------------------------------------------------
C5HDR2_E1B19K-01        ga------------------------------------------------
D3GBW3_E1B19K-01        ga------------------------------------------------
T1UK99_E1B19K-01        ga------------------------------------------------
G1FBW4_E1B19K-01        ga------------------------------------------------
T1UKQ0_E1B19K-01        ga------------------------------------------------
M0QVP5_E1B19K-01        ga------------------------------------------------
H5T740_E1B19K-01        ga------------------------------------------------
M0QUW8_E1B19K-01        ga------------------------------------------------
E1CIJ0_E1B19K-01        ga------------------------------------------------
T1UGU0_E1B19K-01        ga------------------------------------------------
M0QV47_E1B19K-01        ga------------------------------------------------
T1UGY3_E1B19K-02        aaatgaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A1P8C849_E1B19K-      aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
A0A1P7YYY5_E1B19K-      aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
T1UG22_E1B19K-02        aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
A0A1P7YWR9_E1B19K-      aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
A0A1P7YXN8_E1B19K-      aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
A0A1P7YWY2_E1B19K-      aaatgaggtatccagcctatacccagagcttagcaaggtgctgac-----
M0QU02_E1B19K-02        gaatcaggtatccagcctatacccagagcttagcagggtcctgaccaacg
M0QUS9_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QV47_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UGU0_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QUW8_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgttgac-----
M0QVP5_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
G1FBW4_E1B19K-02        gaatcaggtatccagcctgtatccagagcttagcaaggtgctgac-----
T1UKQ0_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgttgac-----
F8UFP5_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
T1UGT5_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A384ZUM9_E1B19K-      gaatcaggtagccagcctgtacccagagcttagcaaggtgctgac-----
M0QV87_E1B19K-02        gagtcaggtatccagcctgtaccctgagctaagcaaggtgttgac-----
T1UKV6_E1B19K-02        gaatcaggtatccagcctgtaccctgagcttagcagggtgctgac-----
A0A3S6PYX7_E1B19K-      gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
C5HDR2_E1B19K-02        gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
A0A097I4T0_E1B19K-      gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
T1UHZ2_E1B19K-02        gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
A0A3Q9FFS0_E1B19K-      gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
M0QVC7_E1B19K-02        gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
M0QU76_E1B19K-02        gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
M0QU41_E1B19K-02        gaatcaggtatccagcttgtacccagagcttagcaaggtgctgac-----
M0QUJ3_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QUF3_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
M0QTS5_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
M0QV08_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
T1UGX3_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
G1FC01_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
G3CK71_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcagggtgctgac-----
A0A0G2UY10_E1B19K-      gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1ULP4_E1B19K-02        gaatcaggtatccagcctgtatccagagcttagcaaggtgctgac-----
F1DT57_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UHQ8_E1B19K-02        gaatcaggtagccagcctgtacccagagcttagcaaggtgctgac-----
T1UHL7_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A075TSZ1_E1B19K-      gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
C4P207_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A8F5PHF8_E1B19K-      gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UHG3_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A384ZUF2_E1B19K-      gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QUN2_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
E1AI10_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QVK6_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UHH6_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UK99_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QVG6_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1UKP8_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
W8CZB0_E1B19K-02        gaatcaggtagccagcctatacccagagcttagtaaggtgctgac-----
M0QUB4_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
M0QVT4_E1B19K-02        gaatcaggtagccagcctgtacccagagcttagcaaggtgctgac-----
E9P585_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
T1ULJ8_E1B19K-02        gaatcaggtatccagcctgtacccagagcttagcaaggtgctgac-----
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      tataccccaatggcctccagaactgagacgcattttaaccattaacgagg
J9Z4N4_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
Q6VGV8_E1B19K-02        ggtggctgaactgtatccagaactgagacgcattttgacaattacagagg
A0A0G2R248_E1B19K-      ggtggctgaactgtatccagaactgagacgcattttgacaattacagagg
A0A4P2SGW2_E1B19K-      ggtggctgaactgtatccagaactgagacgcattttgacaattacagagg
J7I6T8_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
T1UG63_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
E1U5L6_E1B19K-02        ggtggctgaactgtttccagaactgagacgcattttaaccattaacgagg
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        gctgttaacattaagcgggaacg---------------------------
D3JIR7_E1B19K-01        --------------------------------tttgga------------
A0A076V686_E1B19K-      --------------------------------tttgga------------
A0A5H2QAX5_E1B19K-      gttgttaaa---aagcgggaaagaaaagaaagtttaaa------------
T1UEX7_E1B19K-02        gttgttaaa---aagcgggaaagaaaagaaagtttaaa------------
P04492_E1B19K-02        gatgatagagataagcaggaaaaaaaagaaagtttaaa------------
G1DE13_E1B19K-01        --------------------------------tttgga------------
A0A5H2QAX5_E1B19K-      --------------------------------tttgga------------
D0Z5R9_E1B19K-01        --------------------------------tttgga------------
T1UEX7_E1B19K-01        --------------------------------tttgga------------
A0A3G8WH01_E1B19K-      --------------------------------tttgga------------
P04492_E1B19K-01        --------------------------------tttgga------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        aggatgaagaggggcgccaacgcggtcagaagagggagcattttgagtcc
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        ---------gttg----------------------------------gag
A0A6M6AEV2_E1B19K-      ---------gttg----------------------------------gag
A0A142G3J2_E1B19K-      ---------gttg----------------------------------gag
A0A7U3RVU4_E1B19K-      ---------gttg----------------------------------gag
A0A482EVC6_E1B19K-      ---------gtgggcaaaggggggagaaaaggaagttagaaaatgacggg
A0A7U3RWV6_E1B19K-      ---------gttg----------------------------------gag
A0A1S6ELT2_E1B19K-      ---------gttg----------------------------------gag
A0A3G4W995_E1B19K-      ---------gttg----------------------------------gag
A0A898KBW7_E1B19K-      ---------gttg----------------------------------gag
A0A3G8W407_E1B19K-      ---------gttg----------------------------------gag
F4ZCJ8_E1B19K-01        ---------gttg----------------------------------gag
A0A6B9DS29_E1B19K-      ---------gttg----------------------------------gag
A0A8G1GLF6_E1B19K-      ---------gttg----------------------------------gag
B5SNR1_E1B19K-01        ---------gttg----------------------------------gag
P10544_E1B19K-01        ---------gttg----------------------------------gag
A0A482EVC6_E1B19K-      ---------gttg----------------------------------gag
A0A898KBR0_E1B19K-      ---------gttg----------------------------------gag
A0A898KBS1_E1B19K-      ---------gttg----------------------------------gag
W0S1G8_E1B19K-01        ---------gttg----------------------------------gag
A0A6M6AES6_E1B19K-      ---------gttg----------------------------------gag
A0A2H5AI99_E1B19K-      -gttttgg------------------------------------------
A0MK43_E1B19K-02        aacctaga------------------------------------------
A0A0A1EUE4_E1B19K-      -gctttgg------------------------------------------
A0MK43_E1B19K-01        -gctttgg------------------------------------------
A0A2H5AID8_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIL0_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIC5_E1B19K-      -gctttgg------------------------------------------
A0A2H5AI40_E1B19K-      -gctttgg------------------------------------------
A0A2H5AII9_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIN5_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIU0_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIS9_E1B19K-      -gctttgg------------------------------------------
A0A2H5AIT6_E1B19K-      -gctttgg------------------------------------------
Q5C8R2_E1B19K-01        -gttttgg------------------------------------------
A0A2H5AI21_E1B19K-      -gttttgg------------------------------------------
A0A0M5L3Y4_E1B19K-      -gttttgg------------------------------------------
A0A0A1EUC8_E1B19K-      -gttttgg------------------------------------------
A0A2H5AI04_E1B19K-      -gttttgg------------------------------------------
A0A2H5AI72_E1B19K-      -gttttgg------------------------------------------
A0A2H5AIL3_E1B19K-      -gttttgg------------------------------------------
A0A0A1EUB2_E1B19K-      -gttttgg------------------------------------------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatctagtggt
Q32UI6_E1B19K-02        -gtccactggacgggataggggcgttaaaagggagagggcatctagtggt
A0A7G5FB98_E1B19K-      -gtccactggacgggataggggcgttaaaagggagagggcatctagtggt
J7I6W7_E1B19K-02        -gtccactggacgggataggggcgttaaaagggagagggcatctagtggt
W6EIX6_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatgtagtggt
Q3ZL02_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatctagtggt
T1UFS4_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatctagtggt
T1UE63_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatccagtggt
T1UJX4_E1B19K-02        -gtccactggacgggataggggcgttaagagggagagggcatccagtggt
T2CI10_E1B19K-02        -aaccagtggacgggacaggggcattaagagggaaaggaatcctagtgga
Q2Y0J3_E1B19K-02        -gaccagtggacagaacaggggaattaagagggagaggaatcctagtggg
Q5EY83_E1B19K-02        -gaccagtggacagaacaggggaattaagagggagaggaatcctagtggg
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        -gaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
J7ID56_E1B19K-02        -gaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
I6LEP5_E1B19K-02        -aaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        -aaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
I6LES1_E1B19K-03        --------------------------------------------------
R4HLJ6_E1B19K-02        -aaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
Q2KSL3_E1B19K-02        -aaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
T1UF50_E1B19K-02        -aaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
R4HLE1_E1B19K-02        -gaccagtggacagaacaggggcattaagagggagaggaatcctagtggg
P03248_E1B19K-03        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
Q6RK98_E1B19K-02        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
J7I6Q4_E1B19K-02        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
R4HMC6_E1B19K-02        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
I1V161_E1B19K-02        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
A0A5P8KYF0_E1B19K-      -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
J7I6S4_E1B19K-02        -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
A0A897JQR0_E1B19K-      -gaccagtggacagaacagaggcattaagagggagaggaatcctagtggg
K7NG43_E1B19K-02        -gtccagtggacaggacaggggcattaagagggagaggaatcctagtggg
Q3ZKW2_E1B19K-02        -gtccagtggacaggacaggggcattaagagggaaaggaatcctagtggg
Q2KRU2_E1B19K-02        -gtccagtggacaggacaggggcattaagagggaaaggaatcctagtggg
T1UIP3_E1B19K-02        -gtccagtggacaggacaggggcattaagagggaaaggaatcctagtggg
Q2KS85_E1B19K-02        -gtccagtggacaggacaggggcattaagagggagaggaatcctagtggg
A0A0B4SJH1_E1B19K-      -gtccagtggacaggacaggggcattaagagggagaggaatcctagtggg
A0A075IQ70_E1B19K-      -gtccagtggacaggacaggggcattaagagggagaggaatcctagtggg
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        -atccatg---gccaggggagtaaagagggagaggagcgatgggggcaat
A0A1P8C849_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A1P7YYY5_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UG22_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A1P7YWR9_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A1P7YXN8_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A1P7YWY2_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QU02_E1B19K-02        gatccataggtgcgaggggagtgaagagggagaggagcgatggtggcaat
M0QUS9_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QV47_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UGU0_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QUW8_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QVP5_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
G1FBW4_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UKQ0_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
F8UFP5_E1B19K-02        -atccatg---gccaggggagtgaagcgggagaggagcgatgggggcaat
T1UGT5_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A384ZUM9_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QV87_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UKV6_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A3S6PYX7_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
C5HDR2_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggtaat
A0A097I4T0_E1B19K-      -atccatg---gcaaggggagtgaagagggagaggagcgatgggggtaat
T1UHZ2_E1B19K-02        -atccatg---gctaggggagtgaagagggagaggagcgatgggggcaat
A0A3Q9FFS0_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QVC7_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QU76_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QU41_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QUJ3_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QUF3_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QTS5_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QV08_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UGX3_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
G1FC01_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
G3CK71_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A0G2UY10_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1ULP4_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
F1DT57_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UHQ8_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
T1UHL7_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
A0A075TSZ1_E1B19K-      -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
C4P207_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggtaat
A0A8F5PHF8_E1B19K-      -atccatg---gccaggggagttaagagggagaggagcgatgggggtaat
T1UHG3_E1B19K-02        -atccatg---gccaggggagttaagagggagaggagcgatgggggtaat
A0A384ZUF2_E1B19K-      -atccatg---gccaggggagttaagagggagaggagcgatgggggtaat
M0QUN2_E1B19K-02        -atccatg---gccaggggagttaagagggagaggagcgatgggggtaat
E1AI10_E1B19K-02        -atccatg---gccaggggagttaagagggagaggagcgatgggggtaat
M0QVK6_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UHH6_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UK99_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QVG6_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
T1UKP8_E1B19K-02        -atccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
W8CZB0_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
M0QUB4_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagcgatgggggcaat
M0QVT4_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
E9P585_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
T1ULJ8_E1B19K-02        -aaccatg---gccaggggagtgaagagggagaggagtgatgggggcaat
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
J9Z4N4_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
Q6VGV8_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttgtgaggct
A0A0G2R248_E1B19K-      atgggcaggggctaaagggggtaaagagggagcggggggcttgtgaggct
A0A4P2SGW2_E1B19K-      atgggcaggggctaaagggggtaaagagggagcggggggcttgtgaggct
J7I6T8_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
T1UG63_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
E1U5L6_E1B19K-02        atgggcaggggctaaagggggtaaagagggagcggggggcttctgaggct
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        --------------------------------------------ggaaac
D3JIR7_E1B19K-01        --------------------------------------------gatatc
A0A076V686_E1B19K-      --------------------------------------------gatatc
A0A5H2QAX5_E1B19K-      --------------------------------------------ggaagc
T1UEX7_E1B19K-02        --------------------------------------------ggaaac
P04492_E1B19K-02        --------------------------------------------ggaagc
G1DE13_E1B19K-01        --------------------------------------------gatatc
A0A5H2QAX5_E1B19K-      --------------------------------------------gatatc
D0Z5R9_E1B19K-01        --------------------------------------------gatatc
T1UEX7_E1B19K-01        --------------------------------------------gatatc
A0A3G8WH01_E1B19K-      --------------------------------------------gatatc
P04492_E1B19K-01        --------------------------------------------ggtatc

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        tcaactttcttggctgatgtaaccgtggccctgatggcgaaaaacaggct
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        aatccttttt-----ggctcaactttaa--ctaatgt-------------
A0A6M6AEV2_E1B19K-      aatccttttt-----ggctcaactttaa--ctaatgt-------------
A0A142G3J2_E1B19K-      aatccttttt-----ggctcaactttag--ctaatgt-------------
A0A7U3RVU4_E1B19K-      aatccttttt-----ggctcaactttag--ctaatgt-------------
A0A482EVC6_E1B19K-      gcggattttctaaaggagttaaccttgagtttaatgtctcgttgttatcc
A0A7U3RWV6_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A1S6ELT2_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A3G4W995_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A898KBW7_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A3G8W407_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
F4ZCJ8_E1B19K-01        gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A6B9DS29_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A8G1GLF6_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
B5SNR1_E1B19K-01        gtttattttt-----ggttcaaccttaa--ctaatgt-------------
P10544_E1B19K-01        gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A482EVC6_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A898KBR0_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A898KBS1_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
W0S1G8_E1B19K-01        gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A6M6AES6_E1B19K-      gtttattttt-----ggttcaaccttaa--ctaatgt-------------
A0A2H5AI99_E1B19K-      ---aggttt-----tgttttggctcgaccctta--------gcaacgt--
A0MK43_E1B19K-02        ---aactttttgaatgagttgactgtaagcctaatgaatcggcagcgtcc
A0A0A1EUE4_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0MK43_E1B19K-01        ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AID8_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIL0_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIC5_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AI40_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AII9_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIN5_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIU0_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIS9_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
A0A2H5AIT6_E1B19K-      ---aggttt-----tggtttggctcaacgctta--------gcagcgt--
Q5C8R2_E1B19K-01        ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A2H5AI21_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A0M5L3Y4_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A0A1EUC8_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A2H5AI04_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A2H5AI72_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A2H5AIL3_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A0A1EUB2_E1B19K-      ---aggttt-----tgttttggctcaacgctta--------gcaacgt--
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        ------------------gtg-----------------------------
Q6QPB7_E1B19K-01        ------------------gtg-----------------------------
Q6QPI9_E1B19K-01        ------------------gtg-----------------------------
G9G841_E1B19K-01        ------------------gtg-----------------------------
Q8UY91_E1B19K-01        ------------------gtg-----------------------------
P10406_E1B19K-01        ------------------gtg-----------------------------
Q5GFC7_E1B19K-02        ------------------gtg-----------------------------
A0A2R3WN62_E1B19K-      ------------------gtg-----------------------------
A0A3G9CMQ4_E1B19K-      ------------------gtg-----------------------------
Q5GFC7_E1B19K-01        ------------------gtg-----------------------------
Q5GFC8_E1B19K-01        ------------------gtg-----------------------------
Q6H1D7_E1B19K-01        ------------------gtg-----------------------------
A0A3G9JTX5_E1B19K-      ------------------gtg-----------------------------
Q2KSM8_E1B19K-02        ------------------gtg-----------------------------
A0A2R3WNP3_E1B19K-      ------------------gtg-----------------------------
A0A3G8W6L2_E1B19K-      ------------------gtg-----------------------------
A0A3G9K5X3_E1B19K-      ------------------gtg-----------------------------
Q2KSG6_E1B19K-01        ------------------gtg-----------------------------
Q2KSM8_E1B19K-01        ------------------gtg-----------------------------
A0A2R3WN16_E1B19K-      ------------------gtg-----------------------------
Q2KSG6_E1B19K-02        ------------------gtg-----------------------------
A0A2L1F392_E1B19K-      ------------------gtg-----------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        ------------------ttg-----------------------------
Q7T951_E1B19K-01        ------------------ttg-----------------------------
T1UE63_E1B19K-01        ------------------ttg-----------------------------
Q7T8D8_E1B19K-01        ------------------ttg-----------------------------
Q5UW22_E1B19K-01        ------------------ttg-----------------------------
Q8B8U7_E1B19K-01        ------------------ttg-----------------------------
Q32UI6_E1B19K-01        ------------------ttg-----------------------------
A0A7G5FB98_E1B19K-      ------------------ttg-----------------------------
A0A7G5F9T0_E1B19K-      ------------------ttg-----------------------------
J7H4R9_E1B19K-01        ------------------ttg-----------------------------
D2DM83_E1B19K-01        ------------------ttg-----------------------------
J7I6W7_E1B19K-01        ------------------ttg-----------------------------
C7SRS7_E1B19K-01        ------------------ttg-----------------------------
A0A7U3S1T6_E1B19K-      ------------------ttg-----------------------------
A0A7U3S224_E1B19K-      ------------------ttg-----------------------------
W6EIX6_E1B19K-01        ------------------ttg-----------------------------
A0A1L7NRH1_E1B19K-      ------------------ttg-----------------------------
Q3ZL02_E1B19K-01        ------------------ttg-----------------------------
T1UFS4_E1B19K-01        ------------------ttg-----------------------------
T2CI10_E1B19K-01        ------------------ttg-----------------------------
A0A0K0PX35_E1B19K-      ------------------ttg-----------------------------
A0A0K0PX99_E1B19K-      ------------------ttg-----------------------------
Q3ZKW2_E1B19K-01        ------------------ttg-----------------------------
Q2KRU2_E1B19K-01        ------------------ttg-----------------------------
K7NG43_E1B19K-01        ------------------ttg-----------------------------
Q2KS85_E1B19K-01        ------------------ttg-----------------------------
A0A0B4SJH1_E1B19K-      ------------------ttg-----------------------------
A0A075IQ70_E1B19K-      ------------------ttg-----------------------------
T1UIP3_E1B19K-01        ------------------ttg-----------------------------
R4HLE1_E1B19K-01        ------------------ttg-----------------------------
Q5EY83_E1B19K-01        ------------------ttg-----------------------------
Q2Y0J3_E1B19K-01        ------------------ttg-----------------------------
R4HMC6_E1B19K-01        ------------------ttg-----------------------------
A0A897JQR0_E1B19K-      ------------------ttg-----------------------------
I1V161_E1B19K-01        ------------------ttg-----------------------------
A0A5P8KYF0_E1B19K-      ------------------ttg-----------------------------
J7I6S4_E1B19K-01        ------------------ttg-----------------------------
A0A220VZ73_E1B19K-      ------------------ttg-----------------------------
P03248_E1B19K-02        ------------------ttg-----------------------------
Q6RK98_E1B19K-01        ------------------ttg-----------------------------
J7I6Q4_E1B19K-01        ------------------ttg-----------------------------
A0A8B0LCV0_E1B19K-      ------------------ttg-----------------------------
J7ID56_E1B19K-01        ------------------ttg-----------------------------
I6LEP5_E1B19K-01        ------------------ttg-----------------------------
A0A6M6AA96_E1B19K-      ------------------ttg-----------------------------
A0A8B0LD36_E1B19K-      ------------------ttg-----------------------------
A0A8B0LBX6_E1B19K-      ------------------ttg-----------------------------
A0A8B0L9Y2_E1B19K-      ------------------ttg-----------------------------
R4HLJ6_E1B19K-01        ------------------ttg-----------------------------
R4HLA0_E1B19K-01        ------------------ttg-----------------------------
Q2KSL3_E1B19K-01        ------------------ttg-----------------------------
A0A5J6CTQ0_E1B19K-      ------------------ttg-----------------------------
I6LES1_E1B19K-01        ------------------ttg-----------------------------
T1UF50_E1B19K-01        ------------------ttg-----------------------------
Q7T8D8_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
Q32UI6_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
A0A7G5FB98_E1B19K-      actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
J7I6W7_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
W6EIX6_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
Q3ZL02_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
T1UFS4_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
T1UE63_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcc
T1UJX4_E1B19K-02        actgatgctagatctgagttggctttaagtttaatgtctcgcagacgtcc
T2CI10_E1B19K-02        actaatcccagatctgagttggctttaagtttgatgagtcgcagacgtcc
Q2Y0J3_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
Q5EY83_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
J7ID56_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
I6LEP5_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
I6LEP5_E1B19K-03        ---------------------------------atgagccgcaggcgtcc
I6LES1_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
I6LES1_E1B19K-03        ---------------------------------atgagccgcaggcgtcc
R4HLJ6_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
Q2KSL3_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
T1UF50_E1B19K-02        aacaattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
R4HLE1_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
P03248_E1B19K-03        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
Q6RK98_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
J7I6Q4_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
R4HMC6_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
I1V161_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
A0A5P8KYF0_E1B19K-      aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
J7I6S4_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
A0A897JQR0_E1B19K-      aataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcc
K7NG43_E1B19K-02        aataatttaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
Q3ZKW2_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
Q2KRU2_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
T1UIP3_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
Q2KS85_E1B19K-02        aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
A0A0B4SJH1_E1B19K-      aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
A0A075IQ70_E1B19K-      aataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcc
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        ------------attgacttactcacttttccgccggcgcccggttctcc
Q71BY5_E1B19K-02        ------------attgacttactcacttttccgccggcgcccggttctcc
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        accgggctgatgaccgagctaactgccagcctgatgaatcgcaagcgccc
A0A1P8C849_E1B19K-      actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
A0A1P7YYY5_E1B19K-      actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
T1UG22_E1B19K-02        actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
A0A1P7YWR9_E1B19K-      actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
A0A1P7YXN8_E1B19K-      actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
A0A1P7YWY2_E1B19K-      actgggctgatgacccagctaactgccagcctaatgaatcgcaagcgccc
M0QU02_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcgcaagcgccc
M0QUS9_E1B19K-02        actgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
M0QV47_E1B19K-02        actgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
T1UGU0_E1B19K-02        actgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
M0QUW8_E1B19K-02        accgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
M0QVP5_E1B19K-02        actgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
G1FBW4_E1B19K-02        accgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
T1UKQ0_E1B19K-02        accgggatgatgaccgagctgacagccagcctgatgaatcgcaggcgacc
F8UFP5_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
T1UGT5_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
A0A384ZUM9_E1B19K-      accgggatgatgaccgagttgacggccagcctgatgaatcgtaagcgccc
M0QV87_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
T1UKV6_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
A0A3S6PYX7_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
C5HDR2_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
A0A097I4T0_E1B19K-      accgggatgatgaccgagctaacggccagcctgatgaatcgcaagcgccc
T1UHZ2_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
A0A3Q9FFS0_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QVC7_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QU76_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QU41_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QUJ3_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcgcaagcgccc
M0QUF3_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgtcc
M0QTS5_E1B19K-02        accgggatgatgacagagctgacggccagcctgatgaatcgcaagcgccc
M0QV08_E1B19K-02        accgggatgatgacagagctgacggccagcctgatgaatcgcaagcgccc
T1UGX3_E1B19K-02        accgggatgatgacagagctgacggccagcctgatgaatcgcaagcgccc
G1FC01_E1B19K-02        accgggatgatgacagagctgacggccagtctgatgaatcgcaagcgccc
G3CK71_E1B19K-02        accgggatgatgacagagctgacggccagtctgatgaatcgcaagcgccc
A0A0G2UY10_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
T1ULP4_E1B19K-02        accgggatgatgaccgagctaactgccagcctgatgaatcgcaagcgccc
F1DT57_E1B19K-02        accgggatgatgaccgagctgacggccagtctgatgaatcgcaagcgccc
T1UHQ8_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcgcaagcgccc
T1UHL7_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgtcc
A0A075TSZ1_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgtcc
C4P207_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
A0A8F5PHF8_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
T1UHG3_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
A0A384ZUF2_E1B19K-      accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
M0QUN2_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
E1AI10_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcggaagcgccc
M0QVK6_E1B19K-02        accgggatgatgaccgagctgactgccagtctgatgaatcgcaagcgccc
T1UHH6_E1B19K-02        accgggatgatgaccgagctgactgccagtctgatgaatcggaagcgccc
T1UK99_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QVG6_E1B19K-02        accgggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
T1UKP8_E1B19K-02        accgggatgatgaccgagctgacggccagcttgatgaatcgcaagcgtcc
W8CZB0_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcgcaagcgccc
M0QUB4_E1B19K-02        acagggatgatgaccgagctgacggccagcctgatgaatcgcaagcgccc
M0QVT4_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcgcaagcgccc
E9P585_E1B19K-02        accgggatgatgaccgagctgactgccagcctgatgaatcggaagcgccc
T1ULJ8_E1B19K-02        accgggatgatgaccgagctgactgccagcctcatgaatcggaagcgccc
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      acagaggaggttaggaatttaacttttagcttcaaaatcagtcccctggc
J9Z4N4_E1B19K-02        acagaggaggttaggaatttaacttttagcttaatgaccagacaccgtcc
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        acagaggaggttaggaatttaacttttagcttaatgaccagacaccgtcc
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        acagaggaggttaggaatctaacttttagcttaatgaccagacaccgtcc
Q6VGV8_E1B19K-02        acagaggaggctaggaatctagcttttagcttaatgaccagacaccgtcc
A0A0G2R248_E1B19K-      acagaggaggctaggaatctagcttttagcttaatgaccagacaccgtcc
A0A4P2SGW2_E1B19K-      acagaggaggctaggaatctagcttttagcttaatgaccagacaccgtcc
J7I6T8_E1B19K-02        acagaggaggttaggaatctaacttttagcttaatgaccagacaccgtcc
T1UG63_E1B19K-02        acagaggaggttaggaatctaacttttagcttaatgaccagacaccgtcc
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        acagaggaggctaggaatctaacttttagcttaatgaccagacaccgtcc
E1U5L6_E1B19K-02        acagaggaggctaggaatctaacttttagcttaatgaccagacaccgtcc
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        ggtt-----cttagtaggctagctgttaatataatgtctcgcccgcgctt
D3JIR7_E1B19K-01        tgtttgggtct---------------------------------------
A0A076V686_E1B19K-      tgtttgggtct---------------------------------------
A0A5H2QAX5_E1B19K-      tgtc-----cttaataggctgactgttaacctaatgtctcgcccgcgctt
T1UEX7_E1B19K-02        tgtc-----cttaataggctgactgttaacctaatgtctcgcccgcgctt
P04492_E1B19K-02        tgct--gttcttagtaggctaactgttaatctgatgtcccgcccgcgttt
G1DE13_E1B19K-01        tgtttggttct---------------------------------------
A0A5H2QAX5_E1B19K-      tgtttggttct---------------------------------------
D0Z5R9_E1B19K-01        tgtttggttct---------------------------------------
T1UEX7_E1B19K-01        tgtttggttct---------------------------------------
A0A3G8WH01_E1B19K-      tgtttggctct---------------------------------------
P04492_E1B19K-01        tgtttggctct---------------------------------------

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        --------------------------------------------------
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        ggaggtggtgtggtacccggaagtatgggaggactttgagaagggggact
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        --------------------------------------------------
A0A6M6AEV2_E1B19K-      --------------------------------------------------
A0A142G3J2_E1B19K-      --------------------------------------------------
A0A7U3RVU4_E1B19K-      --------------------------------------------------
A0A482EVC6_E1B19K-      tgagtctgtctggtgggctgatttggaagatgagtttaaaaatggaaaca
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
A0A6B9DS29_E1B19K-      --------------------------------------------------
A0A8G1GLF6_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A6M6AES6_E1B19K-      --------------------------------------------------
A0A2H5AI99_E1B19K-      ------ggtgtacaggg------------------taaaaaaggagca--
A0MK43_E1B19K-02        tgagacggtgttttgggctgagttggaggatgagttcaagaagggggaat
A0A0A1EUE4_E1B19K-      ------agtgtacaggg------------------tcaagaaggagca--
A0MK43_E1B19K-01        ------agtttataggg------------------taaaaagagagca--
A0A2H5AID8_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIL0_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIC5_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AI40_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AII9_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIN5_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIU0_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIS9_E1B19K-      ------agtttatagag------------------taaaaagagagca--
A0A2H5AIT6_E1B19K-      ------agtttatagag------------------taaaaagagagca--
Q5C8R2_E1B19K-01        ------gctatataggg------------------tcaagaaggagca--
A0A2H5AI21_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A0M5L3Y4_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A0A1EUC8_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A2H5AI04_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A2H5AI72_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A2H5AIL3_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A0A1EUB2_E1B19K-      ------gctatataggg------------------tcaagaaggagca--
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        -------------------gagattc------------------------
Q6QPB7_E1B19K-01        -------------------gagattc------------------------
Q6QPI9_E1B19K-01        -------------------gagattc------------------------
G9G841_E1B19K-01        -------------------gagattc------------------------
Q8UY91_E1B19K-01        -------------------gagattc------------------------
P10406_E1B19K-01        -------------------gagattc------------------------
Q5GFC7_E1B19K-02        -------------------gagattc------------------------
A0A2R3WN62_E1B19K-      -------------------gagattc------------------------
A0A3G9CMQ4_E1B19K-      -------------------gagattc------------------------
Q5GFC7_E1B19K-01        -------------------gagattc------------------------
Q5GFC8_E1B19K-01        -------------------gagattc------------------------
Q6H1D7_E1B19K-01        -------------------gagattc------------------------
A0A3G9JTX5_E1B19K-      -------------------gagattt------------------------
Q2KSM8_E1B19K-02        -------------------gagattt------------------------
A0A2R3WNP3_E1B19K-      -------------------gagattt------------------------
A0A3G8W6L2_E1B19K-      -------------------gagattt------------------------
A0A3G9K5X3_E1B19K-      -------------------gagattt------------------------
Q2KSG6_E1B19K-01        -------------------gagattt------------------------
Q2KSM8_E1B19K-01        -------------------gagattt------------------------
A0A2R3WN16_E1B19K-      -------------------gagattt------------------------
Q2KSG6_E1B19K-02        -------------------gagattt------------------------
A0A2L1F392_E1B19K-      -------------------gagattt------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        -------------------gagattc------------------------
Q7T951_E1B19K-01        -------------------gagattc------------------------
T1UE63_E1B19K-01        -------------------gagattc------------------------
Q7T8D8_E1B19K-01        -------------------gagattc------------------------
Q5UW22_E1B19K-01        -------------------gagattc------------------------
Q8B8U7_E1B19K-01        -------------------gagattc------------------------
Q32UI6_E1B19K-01        -------------------gagattc------------------------
A0A7G5FB98_E1B19K-      -------------------gagattc------------------------
A0A7G5F9T0_E1B19K-      -------------------gagattc------------------------
J7H4R9_E1B19K-01        -------------------gagattc------------------------
D2DM83_E1B19K-01        -------------------gagattc------------------------
J7I6W7_E1B19K-01        -------------------gagattc------------------------
C7SRS7_E1B19K-01        -------------------gagattc------------------------
A0A7U3S1T6_E1B19K-      -------------------gagattc------------------------
A0A7U3S224_E1B19K-      -------------------gagattc------------------------
W6EIX6_E1B19K-01        -------------------gagattc------------------------
A0A1L7NRH1_E1B19K-      -------------------gagattc------------------------
Q3ZL02_E1B19K-01        -------------------gagattc------------------------
T1UFS4_E1B19K-01        -------------------gagattc------------------------
T2CI10_E1B19K-01        -------------------gagattc------------------------
A0A0K0PX35_E1B19K-      -------------------gagattc------------------------
A0A0K0PX99_E1B19K-      -------------------gagattc------------------------
Q3ZKW2_E1B19K-01        -------------------gagattc------------------------
Q2KRU2_E1B19K-01        -------------------gagattc------------------------
K7NG43_E1B19K-01        -------------------gagattc------------------------
Q2KS85_E1B19K-01        -------------------gagattc------------------------
A0A0B4SJH1_E1B19K-      -------------------gagattc------------------------
A0A075IQ70_E1B19K-      -------------------gagattc------------------------
T1UIP3_E1B19K-01        -------------------gagattc------------------------
R4HLE1_E1B19K-01        -------------------gagattc------------------------
Q5EY83_E1B19K-01        -------------------gagattc------------------------
Q2Y0J3_E1B19K-01        -------------------gagattc------------------------
R4HMC6_E1B19K-01        -------------------gagattc------------------------
A0A897JQR0_E1B19K-      -------------------gagattc------------------------
I1V161_E1B19K-01        -------------------gagattc------------------------
A0A5P8KYF0_E1B19K-      -------------------gagattc------------------------
J7I6S4_E1B19K-01        -------------------gagattc------------------------
A0A220VZ73_E1B19K-      -------------------gagattc------------------------
P03248_E1B19K-02        -------------------gagattc------------------------
Q6RK98_E1B19K-01        -------------------gagattc------------------------
J7I6Q4_E1B19K-01        -------------------gagattc------------------------
A0A8B0LCV0_E1B19K-      -------------------gagattc------------------------
J7ID56_E1B19K-01        -------------------gagattc------------------------
I6LEP5_E1B19K-01        -------------------gagattc------------------------
A0A6M6AA96_E1B19K-      -------------------gagattc------------------------
A0A8B0LD36_E1B19K-      -------------------gagattc------------------------
A0A8B0LBX6_E1B19K-      -------------------gagattc------------------------
A0A8B0L9Y2_E1B19K-      -------------------gagattc------------------------
R4HLJ6_E1B19K-01        -------------------gagattc------------------------
R4HLA0_E1B19K-01        -------------------gagattc------------------------
Q2KSL3_E1B19K-01        -------------------gagattc------------------------
A0A5J6CTQ0_E1B19K-      -------------------gagattc------------------------
I6LES1_E1B19K-01        -------------------gagattc------------------------
T1UF50_E1B19K-01        -------------------gagattc------------------------
Q7T8D8_E1B19K-02        tgaaaccatttggtggcatgaggttcagaaagagggaagggatgaagttt
Q32UI6_E1B19K-02        tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
A0A7G5FB98_E1B19K-      tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
J7I6W7_E1B19K-02        tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
W6EIX6_E1B19K-02        tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
Q3ZL02_E1B19K-02        tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
T1UFS4_E1B19K-02        tgaaaccatttggtggcatgaggtccagaaagagggaagggatgaagttt
T1UE63_E1B19K-02        tgaaaccatttggtggcatgaggttcagaaagagggaagggatgaagttt
T1UJX4_E1B19K-02        tgaaaccatttggtggcatgaggttcagaaagagggaagggatgaagttt
T2CI10_E1B19K-02        tgaaactatatggtggcatgaggttcagaatgagggcagggatgaagtat
Q2Y0J3_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q5EY83_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
J7ID56_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
I6LEP5_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
I6LEP5_E1B19K-03        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
I6LES1_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
I6LES1_E1B19K-03        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
R4HLJ6_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q2KSL3_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
T1UF50_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
R4HLE1_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
P03248_E1B19K-03        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q6RK98_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
J7I6Q4_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
R4HMC6_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
I1V161_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
A0A5P8KYF0_E1B19K-      tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
J7I6S4_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
A0A897JQR0_E1B19K-      tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
K7NG43_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q3ZKW2_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q2KRU2_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
T1UIP3_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
Q2KS85_E1B19K-02        tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
A0A0B4SJH1_E1B19K-      tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
A0A075IQ70_E1B19K-      tgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagttt
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        ggagccgcctcacctttcccggcagcccgagcagccggagcagag-----
Q71BY5_E1B19K-02        ggagccgcctcacctttcccggcagcccgagcagccggagcagag-----
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
A0A1P8C849_E1B19K-      agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
A0A1P7YYY5_E1B19K-      agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
T1UG22_E1B19K-02        agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
A0A1P7YWR9_E1B19K-      agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
A0A1P7YXN8_E1B19K-      agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
A0A1P7YWY2_E1B19K-      agagcgtattacctggcacgagctacagcaggagtgcagggatgagatag
M0QU02_E1B19K-02        agagtgcattacctggcatgagctacagatggagtgcagggatgaggtgg
M0QUS9_E1B19K-02        tgagcgcattacctggcatgagctacagcaggagtgcagggatgagatag
M0QV47_E1B19K-02        tgagcgcattacctggcatgagctacagcaggagtgcagggatgagatag
T1UGU0_E1B19K-02        tgagcgcattacctggcatgagctacagcaggagtgcagggatgagatag
M0QUW8_E1B19K-02        tgagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
M0QVP5_E1B19K-02        tgagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
G1FBW4_E1B19K-02        tgagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
T1UKQ0_E1B19K-02        tgagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
F8UFP5_E1B19K-02        agagcgcattacctggcatgagctacagctggagtgcagggatgaggtcg
T1UGT5_E1B19K-02        agagcgcatcacctggcatgagctacagctggagtgcagggatgaggtgg
A0A384ZUM9_E1B19K-      agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
M0QV87_E1B19K-02        agagcgcattacctggcacgagctacagatcgagtgcagggatgaggtgg
T1UKV6_E1B19K-02        agagcgcattacctggcacgagctacagattgagtgcagggatgaggtgg
A0A3S6PYX7_E1B19K-      agagcgcattacctggcacgagctacagatggagtgcagggatgagttgg
C5HDR2_E1B19K-02        agagcgcattacctggcacgagctacagatggagtgcagggatgagttgg
A0A097I4T0_E1B19K-      agagcgcattacctggcacgagctacagatggagtgcagggatgagttgg
T1UHZ2_E1B19K-02        agagcgcattacctggcacgagctacagatggagtgcagggatgagttgg
A0A3Q9FFS0_E1B19K-      agagcgcattacctggcacgagctacagatggagtgcagggatgagttgg
M0QVC7_E1B19K-02        agagcgcattacatggcacgagctacagatggagtgcagggatgagttgg
M0QU76_E1B19K-02        agagcgcattacatggcacgagctacagatggagtgcagggatgagttgg
M0QU41_E1B19K-02        agagcgcattacatggcacgagctacagatggagtgcagggatgagttgg
M0QUJ3_E1B19K-02        agagcgcattacctggcatgagctacagatggagtgcagggatgagatag
M0QUF3_E1B19K-02        agagcgcattacctggcacgagctacagatggagtgtagggatgaggtgg
M0QTS5_E1B19K-02        agagcgcattacctggcatgagctacagatggagtgcagggatgaggtgg
M0QV08_E1B19K-02        agagcgcattacctggcatgagctacagatggagtgcagggatgaggtgg
T1UGX3_E1B19K-02        agagcgcattacctggcatgagctacagatggagtgcagggatgaggtgg
G1FC01_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
G3CK71_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
A0A0G2UY10_E1B19K-      agaacgcattacctggcacgagctacagatggagtgcagggatgaggtgg
T1ULP4_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagatag
F1DT57_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
T1UHQ8_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
T1UHL7_E1B19K-02        agagcgcattacctggcacgagctacagatggagtgcagggatgaggtgg
A0A075TSZ1_E1B19K-      agagcgcattacctggcacgagctacagatggagtgcagggatgaggtgg
C4P207_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
A0A8F5PHF8_E1B19K-      agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
T1UHG3_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
A0A384ZUF2_E1B19K-      agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
M0QUN2_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
E1AI10_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagttgg
M0QVK6_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagatag
T1UHH6_E1B19K-02        agagcgccttacctggtacgagctacagcaagagtgcagggatgagatag
T1UK99_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
M0QVG6_E1B19K-02        agagcgcattacctggcacgagctacagcaagagtgcagggatgagatag
T1UKP8_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
W8CZB0_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
M0QUB4_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
M0QVT4_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
E9P585_E1B19K-02        agagcgccttacctggtacgagctacagcaggagtgcagggatgagatag
T1ULJ8_E1B19K-02        agagcgcattacctggcacgagctacagcaggagtgcagggatgagatag
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      tgagccagtaagtggtcagcagattaaggataattgcgctaatgagcttg
J9Z4N4_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
Q6VGV8_E1B19K-02        tgagtgtattacttttcaacagatcaaggataattgcgctaatgagcttg
A0A0G2R248_E1B19K-      tgagtgtattacttttcaacagatcaaggataattgcgctaatgagcttg
A0A4P2SGW2_E1B19K-      tgagtgtattacttttcaacagatcaaggataattgcgctaatgagcttg
J7I6T8_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
T1UG63_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
E1U5L6_E1B19K-02        tgagtgtgttacttttcagcagattaaggataattgcgctaatgagcttg
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        agaaactgtgtattggcaggaactgcaaaatgagtttcagcaaggagata
D3JIR7_E1B19K-01        --------------------------------actttatgcaaagtggta
A0A076V686_E1B19K-      --------------------------------actttaagcaaagtggta
A0A5H2QAX5_E1B19K-      ggaaactgtatattggcaggaattacaggatgaatttaagcagggacaca
T1UEX7_E1B19K-02        ggaaactgtatattggcaggaattacaggatgaatttaagcagggacaca
P04492_E1B19K-02        ggaaactgtatattggcaggagttgcaggatgaatttcagcggggtgata
G1DE13_E1B19K-01        --------------------------------actttcagcaaggtggta
A0A5H2QAX5_E1B19K-      --------------------------------actttaagcaaggtggta
D0Z5R9_E1B19K-01        --------------------------------actttaagcaaggtggta
T1UEX7_E1B19K-01        --------------------------------actttaagcaaggtggta
A0A3G8WH01_E1B19K-      --------------------------------accttaagcaaggtggta
P04492_E1B19K-01        --------------------------------accttaagcaaggtggta

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        -----------------------aggcagcagcgggagagggagcagcag
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        tgcacctgctggaaaaatataactttgagcaggtgaaaacatactggatg
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        ---------------------aatctatagagctaag-------------
A0A6M6AEV2_E1B19K-      ---------------------aatctatagagctaag-------------
A0A142G3J2_E1B19K-      ---------------------gatttatagagctaag-------------
A0A7U3RVU4_E1B19K-      ---------------------gatttatagagctaag-------------
A0A482EVC6_E1B19K-      tgaatcttttatacaagtatggatttgaacagctgaaaacacattggatg
A0A7U3RWV6_E1B19K-      ---------------------aatttatagagctaaa-------------
A0A1S6ELT2_E1B19K-      ---------------------aatttatagagccaaa-------------
A0A3G4W995_E1B19K-      ---------------------aatttatagagccaaa-------------
A0A898KBW7_E1B19K-      ---------------------aatttatagagccaaa-------------
A0A3G8W407_E1B19K-      ---------------------aatttatagagccaaa-------------
F4ZCJ8_E1B19K-01        ---------------------aatttatagagccaaa-------------
A0A6B9DS29_E1B19K-      ---------------------aatttatagagccaaa-------------
A0A8G1GLF6_E1B19K-      ---------------------aatttatagagctaaa-------------
B5SNR1_E1B19K-01        ---------------------aatttatagagctaaa-------------
P10544_E1B19K-01        ---------------------aatttatagagctaaa-------------
A0A482EVC6_E1B19K-      ---------------------aatttatagagctaaa-------------
A0A898KBR0_E1B19K-      ---------------------aatttatagagctaaa-------------
A0A898KBS1_E1B19K-      ---------------------aatttatagagctaaa-------------
W0S1G8_E1B19K-01        ---------------------aatttatagagctaaa-------------
A0A6M6AES6_E1B19K-      ---------------------aatttatagagctaaa-------------
A0A2H5AI99_E1B19K-      -------------------------------------------------a
A0MK43_E1B19K-02        taaacctcttgtacaagtatgggtttgagcagttgaaaactcactggttg
A0A0A1EUE4_E1B19K-      -------------------------------------------------g
A0MK43_E1B19K-01        -------------------------------------------------g
A0A2H5AID8_E1B19K-      -------------------------------------------------g
A0A2H5AIL0_E1B19K-      -------------------------------------------------g
A0A2H5AIC5_E1B19K-      -------------------------------------------------g
A0A2H5AI40_E1B19K-      -------------------------------------------------g
A0A2H5AII9_E1B19K-      -------------------------------------------------g
A0A2H5AIN5_E1B19K-      -------------------------------------------------g
A0A2H5AIU0_E1B19K-      -------------------------------------------------g
A0A2H5AIS9_E1B19K-      -------------------------------------------------g
A0A2H5AIT6_E1B19K-      -------------------------------------------------g
Q5C8R2_E1B19K-01        -------------------------------------------------g
A0A2H5AI21_E1B19K-      -------------------------------------------------g
A0A0M5L3Y4_E1B19K-      -------------------------------------------------g
A0A0A1EUC8_E1B19K-      -------------------------------------------------g
A0A2H5AI04_E1B19K-      -------------------------------------------------g
A0A2H5AI72_E1B19K-      -------------------------------------------------g
A0A2H5AIL3_E1B19K-      -------------------------------------------------g
A0A0A1EUB2_E1B19K-      -------------------------------------------------g
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        --------------------------------------------------
Q6QPB7_E1B19K-01        --------------------------------------------------
Q6QPI9_E1B19K-01        --------------------------------------------------
G9G841_E1B19K-01        --------------------------------------------------
Q8UY91_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
A0A2R3WN62_E1B19K-      --------------------------------------------------
A0A3G9CMQ4_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A3G9JTX5_E1B19K-      --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        --------------------------------------------------
Q7T951_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
Q8B8U7_E1B19K-01        --------------------------------------------------
Q32UI6_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------
D2DM83_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
W6EIX6_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
Q3ZL02_E1B19K-01        --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
Q3ZKW2_E1B19K-01        --------------------------------------------------
Q2KRU2_E1B19K-01        --------------------------------------------------
K7NG43_E1B19K-01        --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
A0A0B4SJH1_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
R4HLE1_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
Q2Y0J3_E1B19K-01        --------------------------------------------------
R4HMC6_E1B19K-01        --------------------------------------------------
A0A897JQR0_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
R4HLJ6_E1B19K-01        --------------------------------------------------
R4HLA0_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
Q7T8D8_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
Q32UI6_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
A0A7G5FB98_E1B19K-      ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
J7I6W7_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
W6EIX6_E1B19K-02        ctgtattgcaggaaaaatattcactggaacaggtgaaaacatgttggttg
Q3ZL02_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
T1UFS4_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
T1UE63_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
T1UJX4_E1B19K-02        ctgtattgcaggagaaatattcactggaacaggtgaaaacatgttggttg
T2CI10_E1B19K-02        caatattgcaagagaaatattctctagaacaggtgaaaacatgttggttg
Q2Y0J3_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q5EY83_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
J7ID56_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
I6LEP5_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
I6LEP5_E1B19K-03        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
I6LES1_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
I6LES1_E1B19K-03        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
R4HLJ6_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q2KSL3_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
T1UF50_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
R4HLE1_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
P03248_E1B19K-03        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q6RK98_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
J7I6Q4_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
R4HMC6_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
I1V161_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
A0A5P8KYF0_E1B19K-      caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
J7I6S4_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
A0A897JQR0_E1B19K-      caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
K7NG43_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q3ZKW2_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q2KRU2_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
T1UIP3_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
Q2KS85_E1B19K-02        caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
A0A0B4SJH1_E1B19K-      caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
A0A075IQ70_E1B19K-      caatattgcaggagaaatattcactagaacaacttaagacctgttggttg
M9YVF6_E1B19K-01        --------------------------------------------------
A0A0M3TH31_E1B19K-      --------------------------------------------------
M9YXY5_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-01        ------------------------------agccttgggtccggtttcta
Q71BY5_E1B19K-02        ------------------------------agccttgggtccggtttcta
Q71BY5_E1B19K-03        --------------------------------------------------
P06501_E1B19K-01        --------------------------------------------------
A0A0M4N3Z1_E1B19K-      --------------------------------------------------
Q8B6X5_E1B19K-01        --------------------------------------------------
B9A5L5_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-01        --------------------------------------------------
M0QVG6_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
M0QUS9_E1B19K-01        --------------------------------------------------
M0QU02_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
M0QV87_E1B19K-01        --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
W8VNG2_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
W8CZB0_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
M0QTS5_E1B19K-01        --------------------------------------------------
M0QV08_E1B19K-01        --------------------------------------------------
G9JUV5_E1B19K-01        --------------------------------------------------
G1FC01_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
M0QUJ3_E1B19K-01        --------------------------------------------------
H0PPE7_E1B19K-01        --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
Q4KSL0_E1B19K-01        --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
M0QUN2_E1B19K-01        --------------------------------------------------
E1CIM6_E1B19K-01        --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------
Q9YL99_E1B19K-01        --------------------------------------------------
K7ZLN6_E1B19K-01        --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
A0A8F5PHF8_E1B19K-      --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
M0QVT4_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
E9P585_E1B19K-01        --------------------------------------------------
D4N3H6_E1B19K-01        --------------------------------------------------
C4P207_E1B19K-01        --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
B9A5Q1_E1B19K-01        --------------------------------------------------
M0QUB4_E1B19K-01        --------------------------------------------------
M0QVK6_E1B19K-01        --------------------------------------------------
A0A3G8WIY5_E1B19K-      --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHL7_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
F1DT57_E1B19K-01        --------------------------------------------------
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
M0QUF3_E1B19K-01        --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
B9A5T7_E1B19K-01        --------------------------------------------------
A0A7R6T9I9_E1B19K-      --------------------------------------------------
B6C6W8_E1B19K-01        --------------------------------------------------
B9A681_E1B19K-01        --------------------------------------------------
A0A1Y1BYF1_E1B19K-      --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
B2VQE3_E1B19K-01        --------------------------------------------------
M0QU76_E1B19K-01        --------------------------------------------------
M0QVC7_E1B19K-01        --------------------------------------------------
M0QU41_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
C5HDR2_E1B19K-01        --------------------------------------------------
D3GBW3_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
G1FBW4_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
M0QVP5_E1B19K-01        --------------------------------------------------
H5T740_E1B19K-01        --------------------------------------------------
M0QUW8_E1B19K-01        --------------------------------------------------
E1CIJ0_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
M0QV47_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-02        gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
A0A1P8C849_E1B19K-      gtctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
A0A1P7YYY5_E1B19K-      gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
T1UG22_E1B19K-02        gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
A0A1P7YWR9_E1B19K-      gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
A0A1P7YXN8_E1B19K-      gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
A0A1P7YWY2_E1B19K-      gcctgatgcaggataaatatggcctggagcaaataaaaacccattggttg
M0QU02_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaactcactggttg
M0QUS9_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QV47_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1UGU0_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QUW8_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QVP5_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
G1FBW4_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1UKQ0_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggtta
F8UFP5_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1UGT5_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
A0A384ZUM9_E1B19K-      gcttgatgcaggataaatatggcctggagcagataaaaacccattggttg
M0QV87_E1B19K-02        gcctgatgcaggataaatacggcctggagcagataaaaacccactggttg
T1UKV6_E1B19K-02        gcctgatgcaggataaatacggcctggagcagataaaaacccactggttg
A0A3S6PYX7_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
C5HDR2_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
A0A097I4T0_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
T1UHZ2_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
A0A3Q9FFS0_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
M0QVC7_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
M0QU76_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
M0QU41_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacacattggttg
M0QUJ3_E1B19K-02        gcctgatgcaggataaatatggtctggagcagataaaaacccactggtta
M0QUF3_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QTS5_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QV08_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1UGX3_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
G1FC01_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
G3CK71_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
A0A0G2UY10_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1ULP4_E1B19K-02        gcctgatgcaggataaatatggtctggagcagataaaaacccattggttg
F1DT57_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
T1UHQ8_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
T1UHL7_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
A0A075TSZ1_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
C4P207_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
A0A8F5PHF8_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
T1UHG3_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
A0A384ZUF2_E1B19K-      gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
M0QUN2_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
E1AI10_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccattggttg
M0QVK6_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
T1UHH6_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
T1UK99_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
M0QVG6_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
T1UKP8_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaacccactggttg
W8CZB0_E1B19K-02        gcctgatgcaggataaatatgggcttgagcagataaaaactcactggttg
M0QUB4_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
M0QVT4_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
E9P585_E1B19K-02        gcctgatgcaggataaatatggcctggagcagataaaaactcactggttg
T1ULJ8_E1B19K-02        gcctgatgcaggataaatatgggctggagcagataaaaactcactggttg
A0A7L4WIC2_E1B19K-      --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A8F9W8V2_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A3G8W3H5_E1B19K-      --------------------------------------------------
E1U5L6_E1B19K-01        --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
J9Z4N4_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
E1ARN8_E1B19K-04        --------------------------------------------------
J9Z4H6_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
Q6VGV8_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
A0A0G2R248_E1B19K-      atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
A0A4P2SGW2_E1B19K-      atctgctggcgcaaaagtattccatagagcagctgaccacttactggctg
J7I6T8_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
T1UG63_E1B19K-02        atctgctggcgcagaagtattctatagagcagctgaccacttactggctg
E1U5L6_E1B19K-03        --------------------------------------------------
J9Z5H0_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
E1U5L6_E1B19K-02        atctgctggcgcagaagtattccatagagcagctgaccacttactggctg
E1U5L6_E1B19K-04        --------------------------------------------------
D3JIR7_E1B19K-02        tgcatttacagtacaagtatggttttgagcaattaaaaactcactggtta
D3JIR7_E1B19K-01        ca----------------------------------------------ta
A0A076V686_E1B19K-      ca----------------------------------------------ta
A0A5H2QAX5_E1B19K-      tgcatctacaatacaagtacagttttgagcagctaaaaacccactggcta
T1UEX7_E1B19K-02        tgcatctacaatacaagtacagttttgagcagctaaaaacccactggcta
P04492_E1B19K-02        tgcatttacagtacaaatacagttttgaacaattaaaaacccactggtta
G1DE13_E1B19K-01        ca----------------------------------------------ta
A0A5H2QAX5_E1B19K-      ca----------------------------------------------ta
D0Z5R9_E1B19K-01        ca----------------------------------------------ta
T1UEX7_E1B19K-01        ca----------------------------------------------ta
A0A3G8WH01_E1B19K-      aa----------------------------------------------ta
P04492_E1B19K-01        aa----------------------------------------------ta

Q7T8D8_E1B19K-03        --------------------------------------------------
Q6RK98_E1B19K-03        --------------------------------------------------
A0A097IW62_E1B19K-      --------------------------------------------------
A0A0M3TH18_E1B19K-      --------------------------------------------------
A0A1W5PVU4_E1B19K-      --------------------------------------------------
A0A2H4CJZ0_E1B19K-      --------------------------------------------------
H8PFZ1_E1B19K-01        --------------------------------------------------
G0ZAH2_E1B19K-01        cagcaggagggggaaatgactacgagcatatggaggccttccatggaggc
F6KST6_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-02        aacccggatgaggactgggaggtggttttgaaccgatacggcaaggtagc
F2WTG5_E1B19K-01        --------------------------------------------------
Q695T5_E1B19K-01        --------------------------------------------------
H9TER0_E1B19K-01        --------------------------------------------------
A0A1L3INW0_E1B19K-      --------------------------------------------------
P10543_E1B19K-01        ---------gaggagt--------------------------------ac
A0A6M6AEV2_E1B19K-      ---------gaggagt--------------------------------ac
A0A142G3J2_E1B19K-      ---------gaggagt--------------------------------ac
A0A7U3RVU4_E1B19K-      ---------gaggagt--------------------------------ac
A0A482EVC6_E1B19K-      gagccttgggaggactgggaactagctttgaatatgtttgccaaagtggc
A0A7U3RWV6_E1B19K-      ---------gaggact--------------------------------ac
A0A1S6ELT2_E1B19K-      ---------gaggact--------------------------------ac
A0A3G4W995_E1B19K-      ---------gaggact--------------------------------ac
A0A898KBW7_E1B19K-      ---------gaggact--------------------------------ac
A0A3G8W407_E1B19K-      ---------gaggact--------------------------------ac
F4ZCJ8_E1B19K-01        ---------gaggact--------------------------------ac
A0A6B9DS29_E1B19K-      ---------gaggact--------------------------------ac
A0A8G1GLF6_E1B19K-      ---------gaggact--------------------------------ac
B5SNR1_E1B19K-01        ---------gaggact--------------------------------ac
P10544_E1B19K-01        ---------gaggact--------------------------------ac
A0A482EVC6_E1B19K-      ---------gaggact--------------------------------ac
A0A898KBR0_E1B19K-      ---------gaggact--------------------------------ac
A0A898KBS1_E1B19K-      ---------gaggact--------------------------------ac
W0S1G8_E1B19K-01        ---------gaggact--------------------------------ac
A0A6M6AES6_E1B19K-      ---------gaggact--------------------------------ac
A0A2H5AI99_E1B19K-      gctgaacag---------------------------ttttctag------
A0MK43_E1B19K-02        gagccgtgggaggatatggaaatggctctagacacctttgctaaagtggc
A0A0A1EUE4_E1B19K-      gaggggcaa---------------------------ttttctag------
A0MK43_E1B19K-01        gaggcgcag---------------------------tttgctag------
A0A2H5AID8_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIL0_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIC5_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AI40_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AII9_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIN5_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIU0_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIS9_E1B19K-      gaggcgcag---------------------------tttgctag------
A0A2H5AIT6_E1B19K-      gaggcgcag---------------------------tttgctag------
Q5C8R2_E1B19K-01        gagacgcag---------------------------tttgctag------
A0A2H5AI21_E1B19K-      gagacgcag---------------------------tttgctag------
A0A0M5L3Y4_E1B19K-      gagacgcag---------------------------tttgctag------
A0A0A1EUC8_E1B19K-      gagacgcag---------------------------tttgctag------
A0A2H5AI04_E1B19K-      gagacgcag---------------------------tttgctag------
A0A2H5AI72_E1B19K-      gagacgcag---------------------------tttgctag------
A0A2H5AIL3_E1B19K-      gagacgcag---------------------------tttgctag------
A0A0A1EUB2_E1B19K-      gagacgcag---------------------------tttgctag------
A0A0M4NHE0_E1B19K-      --------------------------------------------------
H9AAD9_E1B19K-01        --------------------------------------------------
H9AAK5_E1B19K-01        --------------------------------------------------
H9AAH3_E1B19K-01        --------------------------------------------------
F2WTJ7_E1B19K-01        --------------------------------------------------
F2WTM9_E1B19K-01        --------------------------------------------------
A0A1C8EG46_E1B19K-      --------------------------------------------------
H9AAA8_E1B19K-01        --------------------------------------------------
H9AA76_E1B19K-01        --------------------------------------------------
H9AAN8_E1B19K-01        --------------------------------------------------
H9AAS0_E1B19K-01        --------------------------------------------------
H9AAV3_E1B19K-01        --------------------------------------------------
H9AAY5_E1B19K-01        --------------------------------------------------
M9YVA3_E1B19K-01        --------------------------------------------------
Q6QPF3_E1B19K-01        -----------tgcttcggtgggc----------ctctagctaagctagt
Q6QPB7_E1B19K-01        -----------tgcttcggtgggc----------ctctagctaagctagt
Q6QPI9_E1B19K-01        -----------tgcttcggtgggc----------ctctagctaagctagt
G9G841_E1B19K-01        -----------tgcttcggtggcg----------acctagctaagctagt
Q8UY91_E1B19K-01        -----------tgcttcggtggcg----------acctagctaggctagt
P10406_E1B19K-01        -----------tgcttcggcggtg----------acctagctaagctagt
Q5GFC7_E1B19K-02        -----------tgcttcggcggtg----------acctagctaagctagt
A0A2R3WN62_E1B19K-      -----------tgcttcggcggtg----------acctagctaagctagt
A0A3G9CMQ4_E1B19K-      -----------tgcttcggcggtg----------acctagctaagctagt
Q5GFC7_E1B19K-01        -----------tgcttcggcggtg----------acctagctaagctagt
Q5GFC8_E1B19K-01        -----------tgcttcggcggtg----------acctagctaagctagt
Q6H1D7_E1B19K-01        -----------tgcttcggcggtg----------acctagctaagctagt
A0A3G9JTX5_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
Q2KSM8_E1B19K-02        -----------tgcttcggtggcg----------acctagctaagctagt
A0A2R3WNP3_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
A0A3G8W6L2_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
A0A3G9K5X3_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
Q2KSG6_E1B19K-01        -----------tgcttcggtggcg----------acctagctaagctagt
Q2KSM8_E1B19K-01        -----------tgcttcggtggcg----------acctagctaagctagt
A0A2R3WN16_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
Q2KSG6_E1B19K-02        -----------tgcttcggtggcg----------acctagctaagctagt
A0A2L1F392_E1B19K-      -----------tgcttcggtggcg----------acctagctaagctagt
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q6H1D7_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------
T1UJX4_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
Q7T951_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
T1UE63_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
Q7T8D8_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
Q5UW22_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
Q8B8U7_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
Q32UI6_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
A0A7G5FB98_E1B19K-      -----------tggttcgctagtg----------aattagctagggtagt
A0A7G5F9T0_E1B19K-      -----------tggttcgctagtg----------aattagctagggtagt
J7H4R9_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
D2DM83_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
J7I6W7_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
C7SRS7_E1B19K-01        -----------tggttcgctagtg----------aaatagctagggtagt
A0A7U3S1T6_E1B19K-      -----------tggttcgctagtg----------aaatagctagggtagt
A0A7U3S224_E1B19K-      -----------tggttcgctagtg----------aattagctagggtagt
W6EIX6_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
A0A1L7NRH1_E1B19K-      -----------tggttcgctagtg----------aattagctagggtagt
Q3ZL02_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
T1UFS4_E1B19K-01        -----------tggttcgctagtg----------aattagctagggtagt
T2CI10_E1B19K-01        -----------tggttcggtggtg----------atctggctagactagt
A0A0K0PX35_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
A0A0K0PX99_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
Q3ZKW2_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
Q2KRU2_E1B19K-01        -----------tggttcggtggcg----------atctagctaggctagt
K7NG43_E1B19K-01        -----------tggttcggaggtg----------atctagctaggctagt
Q2KS85_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A0B4SJH1_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
A0A075IQ70_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
T1UIP3_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
R4HLE1_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
Q5EY83_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
Q2Y0J3_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
R4HMC6_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A897JQR0_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
I1V161_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A5P8KYF0_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
J7I6S4_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A220VZ73_E1B19K-      -----------tgcttcggtggtg----------atctagctaggctagt
P03248_E1B19K-02        -----------tggttcggtggtg----------atctagctaggctagt
Q6RK98_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
J7I6Q4_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A8B0LCV0_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
J7ID56_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
I6LEP5_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A6M6AA96_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
A0A8B0LD36_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
A0A8B0LBX6_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
A0A8B0L9Y2_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
R4HLJ6_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
R4HLA0_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
Q2KSL3_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
A0A5J6CTQ0_E1B19K-      -----------tggttcggtggtg----------atctagctaggctagt
I6LES1_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
T1UF50_E1B19K-01        -----------tggttcggtggtg----------atctagctaggctagt
Q7T8D8_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
Q32UI6_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
A0A7G5FB98_E1B19K-      gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
J7I6W7_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
W6EIX6_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
Q3ZL02_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
T1UFS4_E1B19K-02        gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagc
T1UE63_E1B19K-02        gagccagaggatgattgggaggtggccattaaaaattatgccaagatagc
T1UJX4_E1B19K-02        gagccagaggatgattgggaggtggccattaaaaattatgcgaagatagc
T2CI10_E1B19K-02        gagcctgaggatgattgggaggttgccattaggaattatgccaagatagc
Q2Y0J3_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q5EY83_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q5EY83_E1B19K-03        --------------------------------------------------
R4HLA0_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
J7ID56_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
I6LEP5_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
I6LEP5_E1B19K-03        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
I6LES1_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
I6LES1_E1B19K-03        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
R4HLJ6_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q2KSL3_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
T1UF50_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
R4HLE1_E1B19K-02        gaacctgaggatgattgggaagtggccattaggaattatgctaagatatc
P03248_E1B19K-03        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q6RK98_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
J7I6Q4_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
R4HMC6_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
I1V161_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
A0A5P8KYF0_E1B19K-      gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
J7I6S4_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
A0A897JQR0_E1B19K-      gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
K7NG43_E1B19K-02        gaacctgaggatgattgggaagtggccattaggaattatgctaagatatc
Q3ZKW2_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q2KRU2_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
T1UIP3_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
Q2KS85_E1B19K-02        gaacctgaggatgattgggaggtggccattaggaattatgctaagatatc
A0A0B4SJH1_E1B19K-      gaacctgaggatgattg