Dataset for CDS E1B19K of organism Human mastadenovirus E

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6H1D7_E1B19K-02        atggagtcaagaaacccatttcagcagggattaccagctggatttcttag
A0A2R3WN62_E1B19K-      atggag-----------atttggacgg-----------------ttttgg
Q6H1D7_E1B19K-01        atggag-----------atttggacgg-----------------ttttgg
A0A2R3WNP3_E1B19K-      atggag-----------atttggacgg-----------------tcttgg
A0A2L1F392_E1B19K-      atggag-----------atttggacgg-----------------tcttgg
A0A2R3WN16_E1B19K-      atggag-----------atttggacgg-----------------tcttgg
                        ******           ****   * *                 * ** *

Q6H1D7_E1B19K-02        cagtagctttgtggagaacatggaagtgccag----cgcct-gaatgcaa
A0A2R3WN62_E1B19K-      aag--actttcacaagactaggcagctgctagagaacgcctcgaacggag
Q6H1D7_E1B19K-01        aag--actttcacaagactaggcagctgctagagaacgcctcgaacggag
A0A2R3WNP3_E1B19K-      aag--acttttacaagactaggcagctgctagagaacgcctcgaacggag
A0A2L1F392_E1B19K-      aag--acttttacaagactaggcagctgctagagaacgcctcgaacggag
A0A2R3WN16_E1B19K-      aag--acttttacaagactaggcagctgctagagaacgcctcgaacggag
                         **   ****    ***  * * *  *** **    ***** *** * * 

Q6H1D7_E1B19K-02        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
A0A2R3WN62_E1B19K-      tctc---ttacctg----------------------tggagattctg---
Q6H1D7_E1B19K-01        tctc---ttacctg----------------------tggagattctg---
A0A2R3WNP3_E1B19K-      tttc---ttacctg----------------------tggagattttg---
A0A2L1F392_E1B19K-      tttc---ttacctg----------------------tggagattttg---
A0A2R3WN16_E1B19K-      tttc---ttacctg----------------------tggagattttg---
                        * **    *** **                      **  ***  **   

Q6H1D7_E1B19K-02        ctccagcagcaggaggatcaagaagagaatccgagagccggcctggaccc
A0A2R3WN62_E1B19K-      -------------------------------------------------c
Q6H1D7_E1B19K-01        -------------------------------------------------c
A0A2R3WNP3_E1B19K-      -------------------------------------------------c
A0A2L1F392_E1B19K-      -------------------------------------------------c
A0A2R3WN16_E1B19K-      -------------------------------------------------c
                                                                         *

Q6H1D7_E1B19K-02        tccggcggaggagtagctgacctgtttcctgaactgcaccgggtgctgac
A0A2R3WN62_E1B19K-      ttcggcggtgacctagctaagct---------------------------
Q6H1D7_E1B19K-01        ttcggcggtgacctagctaagct---------------------------
A0A2R3WNP3_E1B19K-      ttcggtggcgacctagctaagct---------------------------
A0A2L1F392_E1B19K-      ttcggtggcgacctagctaagct---------------------------
A0A2R3WN16_E1B19K-      ttcggtggcgacctagctaagct---------------------------
                        * *** ** *   ***** * **                           

Q6H1D7_E1B19K-02        taggtcttcgagtggtcgggagaggggtattaagcgggagaggcatgatg
A0A2R3WN62_E1B19K-      --agtct----------------------------------------ata
Q6H1D7_E1B19K-01        --agtct----------------------------------------ata
A0A2R3WNP3_E1B19K-      --agtct----------------------------------------ata
A0A2L1F392_E1B19K-      --agtct----------------------------------------ata
A0A2R3WN16_E1B19K-      --agtct----------------------------------------ata
                           ****                                        ** 

Q6H1D7_E1B19K-02        agactaatcacagaattgaactgactgtgggtctgatgagccgcaagcgt
A0A2R3WN62_E1B19K-      gggccaa--acaggattata------------------------------
Q6H1D7_E1B19K-01        gggccaa--acaggattata------------------------------
A0A2R3WNP3_E1B19K-      ggaccaa--acaggattata------------------------------
A0A2L1F392_E1B19K-      ggaccaa--acaggattata------------------------------
A0A2R3WN16_E1B19K-      ggaccaa--acaggattata------------------------------
                         * * **  **** ***  *                              

Q6H1D7_E1B19K-02        ccagaaacagtgtggtggtatgaggtgcagtcaactggcacagatgaggt
A0A2R3WN62_E1B19K-      --gggaacaatttgaggatat-----------------------------
Q6H1D7_E1B19K-01        --gggaacaatttgaggatat-----------------------------
A0A2R3WNP3_E1B19K-      --aggaacaatttgatgatat-----------------------------
A0A2L1F392_E1B19K-      --aggaacaatttgatgatat-----------------------------
A0A2R3WN16_E1B19K-      --aggaacaatttgatgatat-----------------------------
                           * **** * **  * ***                             

Q6H1D7_E1B19K-02        gtcagtcatgcatgagagattttccctagaacaagtcaagacttgttgg-
A0A2R3WN62_E1B19K-      ----------tttgagagagtgtcct------------ggtctttttgac
Q6H1D7_E1B19K-01        ----------tttgagagagtgtcct------------ggtctttttgac
A0A2R3WNP3_E1B19K-      ----------tttaaaagagtgtcct------------ggtctttttgac
A0A2L1F392_E1B19K-      ----------tttaaaagagtgtcct------------ggtctttttgac
A0A2R3WN16_E1B19K-      ----------tttaaaagagtgtcct------------ggtctttttgac
                                    * * *** * ***              * *** ***  

Q6H1D7_E1B19K-02        --ttggagcctgaggatgattgggaggtagccatcaggaattatgccaag
A0A2R3WN62_E1B19K-      gctcttaacttg----------------ggccatcag------------t
Q6H1D7_E1B19K-01        gctcttaacttg----------------ggccatcag------------t
A0A2R3WNP3_E1B19K-      gctcttaacttg----------------ggccatcag------------t
A0A2L1F392_E1B19K-      gctcttaacttg----------------ggccatcag------------t
A0A2R3WN16_E1B19K-      gctcttaacttg----------------ggccatcag------------t
                          *   * * **                 ********             

Q6H1D7_E1B19K-02        ctggctctgaggccagatagaaagtacaagattactaagctgataaatat
A0A2R3WN62_E1B19K-      ctcactttaa--ccaga---gaatttcaagagcccttgact---------
Q6H1D7_E1B19K-01        ctcactttaa--ccaga---gaatttcaagagcccttgact---------
A0A2R3WNP3_E1B19K-      ctcactttaa--ccaga---gaatttcaagagcccttgact---------
A0A2L1F392_E1B19K-      ctcactttaa--ccaga---gaatttcaagagcccttgact---------
A0A2R3WN16_E1B19K-      ctcactttaa--ccaga---gaatttcaagagcccttgact---------
                        **  ** * *  *****    ** * *****   **   **         

Q6H1D7_E1B19K-02        cagaaatgcctgctacatctcagggaatggggctgaagtggagatctgtc
A0A2R3WN62_E1B19K-      ---------ttactactcctggcagaac--cactgcagcagtagcctttt
Q6H1D7_E1B19K-01        ---------ttactactcctggcagaac--cactgcagcagtagcctttt
A0A2R3WNP3_E1B19K-      ---------ttactactcctggcagaac--cactgcagcagtagcctttt
A0A2L1F392_E1B19K-      ---------ttactactcctggcagaac--cactgcagcagtagcctttt
A0A2R3WN16_E1B19K-      ---------ttactactcctggcagaac--cactgcagcagtagcctttt
                                  * ****  **    ***     *** **  *    ** * 

Q6H1D7_E1B19K-02        tccaggatagagtggctttcagatgctgcatgatgaatatgtacccggga
A0A2R3WN62_E1B19K-      tt------------gctttta-----tttttgacaaat---------gga
Q6H1D7_E1B19K-01        tt------------gctttta-----tttttgacaaat---------gga
A0A2R3WNP3_E1B19K-      tt------------gcttttg-----ttcttgacaaat---------gga
A0A2L1F392_E1B19K-      tt------------gcttttg-----ttcttgacaaat---------gga
A0A2R3WN16_E1B19K-      tt------------gcttttg-----ttcttgacaaat---------gga
                        *             *****       *   ***  ***         ***

Q6H1D7_E1B19K-02        gtggtggacatggatggggtcacctttatgaacatgaggttcaggggaga
A0A2R3WN62_E1B19K-      gtcaagaa-------------acccat------------ttcagcaggga
Q6H1D7_E1B19K-01        gtcaagaa-------------acccat------------ttcagcaggga
A0A2R3WNP3_E1B19K-      gtcaagaa-------------acccat------------ttcagcaggga
A0A2L1F392_E1B19K-      gtcaagaa-------------acccat------------ttcagcaggga
A0A2R3WN16_E1B19K-      gtcaagaa-------------acccat------------ttcagcaggga
                        **   * *             ***  *            *****  * **

Q6H1D7_E1B19K-02        tgggtataatgggacggtctttatggccaataccaagctgacagtgcatg
A0A2R3WN62_E1B19K-      t-----------------------------taccag--------------
Q6H1D7_E1B19K-01        t-----------------------------taccag--------------
A0A2R3WNP3_E1B19K-      t-----------------------------taccag--------------
A0A2L1F392_E1B19K-      t-----------------------------taccag--------------
A0A2R3WN16_E1B19K-      t-----------------------------taccag--------------
                        *                             *****               

Q6H1D7_E1B19K-02        gatgctccttctttgggtttaataacacctgcatcgaggcttggggtcag
A0A2R3WN62_E1B19K-      ------------ctggatttcttagca-----------------------
Q6H1D7_E1B19K-01        ------------ctggatttcttagca-----------------------
A0A2R3WNP3_E1B19K-      ------------ttggatttcttagca-----------------------
A0A2L1F392_E1B19K-      ------------ttggatttcttagca-----------------------
A0A2R3WN16_E1B19K-      ------------ttggatttcttagca-----------------------
                                     *** ***  ** **                       

Q6H1D7_E1B19K-02        gtcggtgttaaggggtgcagtttttcagccaactggatgggggtagtggg
A0A2R3WN62_E1B19K-      ----------------gtagcttt---------------------gtgg-
Q6H1D7_E1B19K-01        ----------------gtagcttt---------------------gtgg-
A0A2R3WNP3_E1B19K-      ----------------gtagcttt---------------------gtgg-
A0A2L1F392_E1B19K-      ----------------gtagcttt---------------------gtgg-
A0A2R3WN16_E1B19K-      ----------------gtagcttt---------------------gtgg-
                                        * ** ***                     **** 

Q6H1D7_E1B19K-02        caggaccaagagtatgctgtctgtgaagaaatgcttgtttgagaggtgcc
A0A2R3WN62_E1B19K-      --------agaacatg--------------------------gaagtgcc
Q6H1D7_E1B19K-01        --------agaacatg--------------------------gaagtgcc
A0A2R3WNP3_E1B19K-      --------agagcatg--------------------------gaagtgcc
A0A2L1F392_E1B19K-      --------agagcatg--------------------------gaagtgcc
A0A2R3WN16_E1B19K-      --------agagcatg--------------------------gaagtgcc
                                ***  ***                          ** *****

Q6H1D7_E1B19K-02        acctgggggtgatgagcgagggcgaagccagaatccgccactgtgcctct
A0A2R3WN62_E1B19K-      agc-----------------------gcctgaat----------------
Q6H1D7_E1B19K-01        agc-----------------------gcctgaat----------------
A0A2R3WNP3_E1B19K-      agc-----------------------gcctgaat----------------
A0A2L1F392_E1B19K-      agc-----------------------gcctgaat----------------
A0A2R3WN16_E1B19K-      agc-----------------------gcctgaat----------------
                        * *                       *** ****                

Q6H1D7_E1B19K-02        accgagacgggctgttttgtgctgtgcaagggcaatgccaagatcaagca
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
                                                                          

Q6H1D7_E1B19K-02        taatatgatctgtggagcctcggacgagcgcggctaccagatgctgacct
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
                                                                          

Q6H1D7_E1B19K-02        gcgccggtgggaacagtcatatgctggccgccgtgcatgtggcttcccat
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      --------------------------------------------------
                                                                          

Q6H1D7_E1B19K-02        tcccgcaagccctggcctgagttcgagcacaatgtcatgaccaggtgcaa
A0A2R3WN62_E1B19K-      ----gcaatc-ccggct---------------------------------
Q6H1D7_E1B19K-01        ----gcaatctccggct---------------------------------
A0A2R3WNP3_E1B19K-      ----gcaatc-ccggct---------------------------------
A0A2L1F392_E1B19K-      ----gcaatc----------------------------------------
A0A2R3WN16_E1B19K-      ----gcaatctccggct---------------------------------
                            **** *                                        

Q6H1D7_E1B19K-02        tatgcatctgggggctcgccgaggcatgtttatgccctaccagtgcaacc
A0A2R3WN62_E1B19K-      ----------------------------------acttgccggtacagcc
Q6H1D7_E1B19K-01        ----------------------------------acttgccggtacagcc
A0A2R3WNP3_E1B19K-      ----------------------------------acttgccggtacagcc
A0A2L1F392_E1B19K-      -------------------------------------tgccggtacagcc
A0A2R3WN16_E1B19K-      ----------------------------------acttgccggtacagcc
                                                             * ** ** ** **

Q6H1D7_E1B19K-02        tgaattatgtaaaggtgctcctggagcccgatgtcatgtccagagtgagc
A0A2R3WN62_E1B19K-      -------------------------gctag--------------------
Q6H1D7_E1B19K-01        -------------------------gctagacactctgaggatcctgagt
A0A2R3WNP3_E1B19K-      -------------------------gctag--------------------
A0A2L1F392_E1B19K-      -------------------------gctag--------------------
A0A2R3WN16_E1B19K-      -------------------------gctagacactctgaggatcctaagt
                                                 **  *                    

Q6H1D7_E1B19K-02        ctgacgggggtgtttgacatgaatgtggaagtgtggaagattctaagata
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        ctc-----------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      ctccagcaaatttccca---------------------------------
                                                                          

Q6H1D7_E1B19K-02        tgatgaatacaagaccaggtgtcgagcctgcgagtgcggagggaagcatg
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        --------------------------------------------------
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      ------------------------------------------ggaacgcc
                                                                          

Q6H1D7_E1B19K-02        ccaggttccagcccgtgtgtgtggatgtgacggaggacctgcgacccgat
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        -----------cagcagcaggaggatcaagaagagaatccgagagccggc
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      aacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggc
                                                                          

Q6H1D7_E1B19K-02        catttggtgttgtcctgcaccgggacggagttcggctccagtggggaaga
A0A2R3WN62_E1B19K-      --------------------------------------------------
Q6H1D7_E1B19K-01        c------------------------------tggaccctccggcggagga
A0A2R3WNP3_E1B19K-      --------------------------------------------------
A0A2L1F392_E1B19K-      --------------------------------------------------
A0A2R3WN16_E1B19K-      c------------------------------tggaccctccggcggagga
                                                                          

Q6H1D7_E1B19K-02        atctgactag
A0A2R3WN62_E1B19K-      ----------
Q6H1D7_E1B19K-01        gtag------
A0A2R3WNP3_E1B19K-      ----------
A0A2L1F392_E1B19K-      ----------
A0A2R3WN16_E1B19K-      ggaggagtag
                                  

© 1998-2022Legal notice