Dataset for CDS E1B19K of organism Human mastadenovirus E

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A2L1F392_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=420 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctgccggtacagccgctag
>gnl|bcl2dbcds|A0A2R3WN16_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=555 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggaggagtag
>gnl|bcl2dbcds|A0A2R3WN62_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=429 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|A0A2R3WNP3_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=429 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q6H1D7_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=516 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggaggatcaagaagagaat
ccgagagccggcctggaccctccggcggaggagtag
>gnl|bcl2dbcds|Q6H1D7_E1B19K-02 E1B19K gene OS=[Viruses] Human mastadenovirus E GN=E1B19K (length=1452 residues).
atggagtcaagaaacccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggag
gatcaagaagagaatccgagagccggcctggaccctccggcggaggagtagctgacctgtttcctgaactgcaccgggtg
ctgactaggtcttcgagtggtcgggagaggggtattaagcgggagaggcatgatgagactaatcacagaattgaactgac
tgtgggtctgatgagccgcaagcgtccagaaacagtgtggtggtatgaggtgcagtcaactggcacagatgaggtgtcag
tcatgcatgagagattttccctagaacaagtcaagacttgttggttggagcctgaggatgattgggaggtagccatcagg
aattatgccaagctggctctgaggccagatagaaagtacaagattactaagctgataaatatcagaaatgcctgctacat
ctcagggaatggggctgaagtggagatctgtctccaggatagagtggctttcagatgctgcatgatgaatatgtacccgg
gagtggtggacatggatggggtcacctttatgaacatgaggttcaggggagatgggtataatgggacggtctttatggcc
aataccaagctgacagtgcatggatgctccttctttgggtttaataacacctgcatcgaggcttggggtcaggtcggtgt
taaggggtgcagtttttcagccaactggatgggggtagtgggcaggaccaagagtatgctgtctgtgaagaaatgcttgt
ttgagaggtgccacctgggggtgatgagcgagggcgaagccagaatccgccactgtgcctctaccgagacgggctgtttt
gtgctgtgcaagggcaatgccaagatcaagcataatatgatctgtggagcctcggacgagcgcggctaccagatgctgac
ctgcgccggtgggaacagtcatatgctggccgccgtgcatgtggcttcccattcccgcaagccctggcctgagttcgagc
acaatgtcatgaccaggtgcaatatgcatctgggggctcgccgaggcatgtttatgccctaccagtgcaacctgaattat
gtaaaggtgctcctggagcccgatgtcatgtccagagtgagcctgacgggggtgtttgacatgaatgtggaagtgtggaa
gattctaagatatgatgaatacaagaccaggtgtcgagcctgcgagtgcggagggaagcatgccaggttccagcccgtgt
gtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtcctgcaccgggacggagttcggctccagtggggaa
gaatctgactag
© 1998-2022Legal notice