Dataset for CDS E1B19K of organism Human adenovirus F serotype 41

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A482EVC6_E1B19K-      atggagcgcccaaacccatctgtcggaggggtatactctggattacatga
A0A1S6ELT2_E1B19K-      atggag--------------ttttggag----------tgagctaca---
A0A3G4W995_E1B19K-      atggag--------------ttttggag----------tgagctgca---
A0A3G8W407_E1B19K-      atggag--------------ttttggag----------tgagctaca---
F4ZCJ8_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
B5SNR1_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
P10544_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
A0A482EVC6_E1B19K-      atggag--------------ttttggag----------tgagctaca---
W0S1G8_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
                        ******              * * ****          **   * **   

A0A482EVC6_E1B19K-      caatggccctgtggagaaccctgctgcggaggaagagggtcttaggttgc
A0A1S6ELT2_E1B19K-      -----------------------------------aagttatcag-----
A0A3G4W995_E1B19K-      -----------------------------------aagttatcag-----
A0A3G8W407_E1B19K-      -----------------------------------aagttatcag-----
F4ZCJ8_E1B19K-01        -----------------------------------aagttatcag-----
B5SNR1_E1B19K-01        -----------------------------------aagttatcag-----
P10544_E1B19K-01        -----------------------------------aagttatcag-----
A0A482EVC6_E1B19K-      -----------------------------------aagttatcag-----
W0S1G8_E1B19K-01        -----------------------------------aagttatcag-----
                                                           * * * * **     

A0A482EVC6_E1B19K-      tcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggagga
A0A1S6ELT2_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A3G4W995_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A3G8W407_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
F4ZCJ8_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
B5SNR1_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
P10544_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
A0A482EVC6_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
W0S1G8_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
                                  ******** *** *          *** ****  **    

A0A482EVC6_E1B19K-      ggaggaggaggaggaggagaacctgagggccggtctggatcctcaaacgg
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------

A0A482EVC6_E1B19K-      aattgtaactgaacctgaccccgaagagggtactagcagtgggcaaaggg
A0A1S6ELT2_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A3G4W995_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A3G8W407_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
F4ZCJ8_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
B5SNR1_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
P10544_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
A0A482EVC6_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
W0S1G8_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
                          ** *  * **** *                * *** ** *        

A0A482EVC6_E1B19K-      gggagaaaaggaagttagaaaatgacggggcggattttctaaaggagtta
A0A1S6ELT2_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A3G4W995_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A3G8W407_E1B19K-      --------------------------gaggtttattttt-----ggttca
F4ZCJ8_E1B19K-01        --------------------------gaggtttattttt-----ggttca
B5SNR1_E1B19K-01        --------------------------gaggtttattttt-----ggttca
P10544_E1B19K-01        --------------------------gaggtttattttt-----ggttca
A0A482EVC6_E1B19K-      --------------------------gaggtttattttt-----ggttca
W0S1G8_E1B19K-01        --------------------------gaggtttattttt-----ggttca
                                                  * **   *****      *  * *

A0A482EVC6_E1B19K-      accttgagtttaatgtctcgttgttatcctgagtctgtctggtgggctga
A0A1S6ELT2_E1B19K-      accttaa--ctaatgt----------------------------------
A0A3G4W995_E1B19K-      accttaa--ctaatgt----------------------------------
A0A3G8W407_E1B19K-      accttaa--ctaatgt----------------------------------
F4ZCJ8_E1B19K-01        accttaa--ctaatgt----------------------------------
B5SNR1_E1B19K-01        accttaa--ctaatgt----------------------------------
P10544_E1B19K-01        accttaa--ctaatgt----------------------------------
A0A482EVC6_E1B19K-      accttaa--ctaatgt----------------------------------
W0S1G8_E1B19K-01        accttaa--ctaatgt----------------------------------
                        ***** *   ******                                  

A0A482EVC6_E1B19K-      tttggaagatgagtttaaaaatggaaacatgaatcttttatacaagtatg
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------

A0A482EVC6_E1B19K-      gatttgaacagctgaaaacacattggatggagccttgggaggactgggaa
A0A1S6ELT2_E1B19K-      aatttatagagccaaa----------------------gaggact-----
A0A3G4W995_E1B19K-      aatttatagagccaaa----------------------gaggact-----
A0A3G8W407_E1B19K-      aatttatagagccaaa----------------------gaggact-----
F4ZCJ8_E1B19K-01        aatttatagagccaaa----------------------gaggact-----
B5SNR1_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
P10544_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
A0A482EVC6_E1B19K-      aatttatagagctaaa----------------------gaggact-----
W0S1G8_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
                         ****  * ***  **                      *******     

A0A482EVC6_E1B19K-      ctagctttgaatatgtttgccaaagtggctcttcgcccagacactattta
A0A1S6ELT2_E1B19K-      ---------------------------actcttcgc--------------
A0A3G4W995_E1B19K-      ---------------------------actcttcgc--------------
A0A3G8W407_E1B19K-      ---------------------------actcttcgc--------------
F4ZCJ8_E1B19K-01        ---------------------------actcttcgc--------------
B5SNR1_E1B19K-01        ---------------------------actcttcgc--------------
P10544_E1B19K-01        ---------------------------actcttcgc--------------
A0A482EVC6_E1B19K-      ---------------------------actcttcgc--------------
W0S1G8_E1B19K-01        ---------------------------actcttcgc--------------

A0A482EVC6_E1B19K-      taccattaagaaaactgttaatatacgtaaatgtgcctatgtaattggaa
A0A1S6ELT2_E1B19K-      ------------------------------------------gatttg--
A0A3G4W995_E1B19K-      ------------------------------------------gatttg--
A0A3G8W407_E1B19K-      ------------------------------------------gatttg--
F4ZCJ8_E1B19K-01        ------------------------------------------gatttg--
B5SNR1_E1B19K-01        ------------------------------------------gatttg--
P10544_E1B19K-01        ------------------------------------------gatttg--
A0A482EVC6_E1B19K-      ------------------------------------------aatttg--
W0S1G8_E1B19K-01        ------------------------------------------gatttg--
                                                                   *** *  

A0A482EVC6_E1B19K-      atggagccgtggttagattccaaacctttgaccgggtggtttttaactgt
A0A1S6ELT2_E1B19K-      -------------------ctgagcttttgtc--------ttttaac---
A0A3G4W995_E1B19K-      -------------------ctgagcttttgtc--------ttttaac---
A0A3G8W407_E1B19K-      -------------------ctgagcttttgtc--------ttttaac---
F4ZCJ8_E1B19K-01        -------------------ctgagcttttgtc--------ttttaac---
B5SNR1_E1B19K-01        -------------------ctgagcttttgtc--------ttttaac---
P10544_E1B19K-01        -------------------ctgagcttttgtc--------ttttaac---
A0A482EVC6_E1B19K-      -------------------ctgagcttttgtc--------ttttaac---
W0S1G8_E1B19K-01        -------------------ctgagcttttgtc--------ttttaac---
                                           *  * * **** *        *******   

A0A482EVC6_E1B19K-      gcaatgcagagtttaggtcctggggtgattggtatgagcggggtaacatt
A0A1S6ELT2_E1B19K-      ------------------cctggaatatttg---------------catc
A0A3G4W995_E1B19K-      ------------------cctggaatttttg---------------catc
A0A3G8W407_E1B19K-      ------------------cctggaatttttg---------------catc
F4ZCJ8_E1B19K-01        ------------------cctggaatttttg---------------catc
B5SNR1_E1B19K-01        ------------------cctggaatttttg---------------catc
P10544_E1B19K-01        ------------------cctggaatttttg---------------catc
A0A482EVC6_E1B19K-      ------------------cctggaatttttg---------------catc
W0S1G8_E1B19K-01        ------------------cctggaatttttg---------------catc
                                          *****  *  ***               *** 

A0A482EVC6_E1B19K-      taataatgtcagatttgcagcagatggatttaatggcaaggtgtttgctt
A0A1S6ELT2_E1B19K-      t-------ttaaatttggg-------------------------------
A0A3G4W995_E1B19K-      t-------ttaaatttggg-------------------------------
A0A3G8W407_E1B19K-      t-------ttaaatttggg-------------------------------
F4ZCJ8_E1B19K-01        t-------ttaaatttggg-------------------------------
B5SNR1_E1B19K-01        t-------ttaaatttggg-------------------------------
P10544_E1B19K-01        t-------ttaaatttggg-------------------------------
A0A482EVC6_E1B19K-      t-------ttaaatttggg-------------------------------
W0S1G8_E1B19K-01        t-------ttaaatttggg-------------------------------
                        *       * * *****                                 

A0A482EVC6_E1B19K-      ctaccactcaattaactttgcatggtgtgttttttcaaaattgcagcggt
A0A1S6ELT2_E1B19K-      ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
A0A3G4W995_E1B19K-      ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
A0A3G8W407_E1B19K-      ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
F4ZCJ8_E1B19K-01        ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
B5SNR1_E1B19K-01        ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
P10544_E1B19K-01        ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
A0A482EVC6_E1B19K-      ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
W0S1G8_E1B19K-01        ccaccactc-----atttttccaggaaattgtgatcaaaaacttagattt
                        * *******     * *** *  **    * *  ******    **   *

A0A482EVC6_E1B19K-      gtttgcgtggattcctggggtagggtgtctgccagaggttg--tacgttt
A0A1S6ELT2_E1B19K-      ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
A0A3G4W995_E1B19K-      ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
A0A3G8W407_E1B19K-      ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
F4ZCJ8_E1B19K-01        ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
B5SNR1_E1B19K-01        ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
P10544_E1B19K-01        ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
A0A482EVC6_E1B19K-      ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
W0S1G8_E1B19K-01        ttcttc-----ccccggccgtacggtttct----gggcttgctttcattt
                         * * *       ** *  *** *** ***    * * ***  * * ***

A0A482EVC6_E1B19K-      gtgggatgttggaaagggctggtggggcaaaacaagagccaaatgtctgt
A0A1S6ELT2_E1B19K-      gttttatattgga-----tcaatggagc--------------------gc
A0A3G4W995_E1B19K-      gttttatattgga-----tcaatggagc--------------------gc
A0A3G8W407_E1B19K-      gttttatattgga-----tcaatggagc--------------------gc
F4ZCJ8_E1B19K-01        gttttatattgga-----tcaatggagc--------------------gc
B5SNR1_E1B19K-01        gttttatattgga-----tcaatggagc--------------------gc
P10544_E1B19K-01        gttttatattgga-----tcaatggagc--------------------gc
A0A482EVC6_E1B19K-      gttttatattgga-----tcaatggagc--------------------gc
W0S1G8_E1B19K-01        gttttatattgga-----tcaatggagc--------------------gc
                        **   ** *****         *** **                    * 

A0A482EVC6_E1B19K-      aaaaaaatgtgtgtttgaacgatgcattttggctatggtggtagaaggcc
A0A1S6ELT2_E1B19K-      ccaaacccatctgtcggaggggtatactctgg------------------
A0A3G4W995_E1B19K-      ccaaacccatctgtcggaggggtatactctgg------------------
A0A3G8W407_E1B19K-      ccaaacccatctgtcggaggggtatactctgg------------------
F4ZCJ8_E1B19K-01        ccaaacccatctgtcggaggggtatactctgg------------------
B5SNR1_E1B19K-01        ccaaacccatctgtcggagggatatactctgg------------------
P10544_E1B19K-01        ccaaacccatctgtcggagggatatactctgg------------------
A0A482EVC6_E1B19K-      ccaaacccatctgtcggaggggtatactctgg------------------
W0S1G8_E1B19K-01        ccaaacccatctgtcggaggggtatactctgg------------------
                          ***    * ***  **  * *  * * ***                  

A0A482EVC6_E1B19K-      aggcgcgaattcgacataatgcgggttccgaaaatgtgtgctttttactg
A0A1S6ELT2_E1B19K-      --------att--acatgacaatggctctg--------------------
A0A3G4W995_E1B19K-      --------att--acatgacaatggccctg--------------------
A0A3G8W407_E1B19K-      --------att--acatgacaatggccctg--------------------
F4ZCJ8_E1B19K-01        --------att--acatgacaatggccctg--------------------
B5SNR1_E1B19K-01        --------att--acatgacaatggccctg--------------------
P10544_E1B19K-01        --------att--acatgacaatggccctg--------------------
A0A482EVC6_E1B19K-      --------att--acatgacaatggccctg--------------------
W0S1G8_E1B19K-01        --------att--acatgacaatggccctg--------------------
                                ***  **** *    **  * *                    

A0A482EVC6_E1B19K-      ctgaagggaactgccagtgttaagcataatatgatttgtggcactggtca
A0A1S6ELT2_E1B19K-      -tggagaaccctgc------------------------------------
A0A3G4W995_E1B19K-      -tggagaaccctgc------------------------------------
A0A3G8W407_E1B19K-      -tggagaaccctgc------------------------------------
F4ZCJ8_E1B19K-01        -tggagaaccctgc------------------------------------
B5SNR1_E1B19K-01        -tggagaaccctgc------------------------------------
P10544_E1B19K-01        -tggagaaccctgc------------------------------------
A0A482EVC6_E1B19K-      -tggagaaccctgc------------------------------------
W0S1G8_E1B19K-01        -tggagaaccctgc------------------------------------
                         ** **    ****                                    

A0A482EVC6_E1B19K-      ctctcagctgctaacttgcgcagatggaaactgtcagactctaaaagtga
A0A1S6ELT2_E1B19K-      ----------------tgcggaggaagagggtctta--------------
A0A3G4W995_E1B19K-      ----------------tgcggaggaagagggtctta--------------
A0A3G8W407_E1B19K-      ----------------tgcggaggaagagggtctta--------------
F4ZCJ8_E1B19K-01        ----------------tgcggaggaagagggtctta--------------
B5SNR1_E1B19K-01        ----------------tgcggaggaagagggtctta--------------
P10544_E1B19K-01        ----------------tgcggaggaagagggtctta--------------
A0A482EVC6_E1B19K-      ----------------tgcggaggaagagggtctta--------------
W0S1G8_E1B19K-01        ----------------tgcggaggaagagggtctta--------------
                                        **** **   **   * * *              

A0A482EVC6_E1B19K-      ttcatgtggtttcccatcagcgccgcccctggcctgtttttgagcataac
A0A1S6ELT2_E1B19K-      -------ggttgctcgccggcgcagcctccgcacggtct-----------
A0A3G4W995_E1B19K-      -------ggttgctcgccggcgcagcctccgcacggtct-----------
A0A3G8W407_E1B19K-      -------ggttgctcgccggcgcagcctccgcacggtct-----------
F4ZCJ8_E1B19K-01        -------ggttgctcgccggcgcagcctccgcacggtct-----------
B5SNR1_E1B19K-01        -------ggttgctcgccggcgcagcctccgcacggtct-----------
P10544_E1B19K-01        -------ggttgctcgccggcgcagcctccgcacggtct-----------
A0A482EVC6_E1B19K-      -------ggttgctcgccggcgcagcctccgcacggtct-----------
W0S1G8_E1B19K-01        -------ggttgctcgccggcgcagcctccgcacggtct-----------
                               **** * *  * **** *** * *  * ** *           

A0A482EVC6_E1B19K-      atgcttatgcgttgtaccatgcatttgggggctcgtcgtggcatgttttc
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------

A0A482EVC6_E1B19K-      tccatatcagagtaatttttgccatactaaagttttaatggaaactgatg
A0A1S6ELT2_E1B19K-      ----------------------------------------ggatccagtg
A0A3G4W995_E1B19K-      ----------------------------------------ggatccagtg
A0A3G8W407_E1B19K-      ----------------------------------------ggatccagtg
F4ZCJ8_E1B19K-01        ----------------------------------------ggatccagtg
B5SNR1_E1B19K-01        ----------------------------------------ggatccagtg
P10544_E1B19K-01        ----------------------------------------ggatccagtg
A0A482EVC6_E1B19K-      ----------------------------------------ggatccagtg
W0S1G8_E1B19K-01        ----------------------------------------ggatccagtg
                                                                * * *   **

A0A482EVC6_E1B19K-      ctttttcgcgggtgtggtggagcggggtgtttgatttgaccatagagctg
A0A1S6ELT2_E1B19K-      c----------g---ggaggaggaggagg---------------------
A0A3G4W995_E1B19K-      c----------g---------------gg---------------------
A0A3G8W407_E1B19K-      c----------g--------------------------------------
F4ZCJ8_E1B19K-01        c----------gggaggaggaggaggagg---------------------
B5SNR1_E1B19K-01        c----------g---ggaggaggaggagg---------------------
P10544_E1B19K-01        c----------g---------ggaggagg---------------------
A0A482EVC6_E1B19K-      c----------g---ggaggaggaggagg---------------------
W0S1G8_E1B19K-01        c----------g---------ggaggagg---------------------
                        *          *                                      

A0A482EVC6_E1B19K-      tataaagtggtgagatatgatgagttaaaggctcgttgtcgcccctgtga
A0A1S6ELT2_E1B19K-      ----aggaggaggagagggagaacctgagggccggtc-------------
A0A3G4W995_E1B19K-      ----aggaggaggaggaggagaacctgagggccggtc-------------
A0A3G8W407_E1B19K-      -----ggaggaggaggaggagaacctgagggccggtc-------------
F4ZCJ8_E1B19K-01        ----aggaggaggaggaggagaacctgagggccggtc-------------
B5SNR1_E1B19K-01        ----aggaggaggaggaggagaacctgagggccggtc-------------
P10544_E1B19K-01        ----aggaggaggaggaggagaacctgagggccggtc-------------
A0A482EVC6_E1B19K-      ----aggaggaggaggaggagaacctgagggccggtc-------------
W0S1G8_E1B19K-01        ----aggaggaggaggaggagaacctgagggccggtc-------------
                              * ** *      **  *  * * ***  **              

A0A482EVC6_E1B19K-      gtgtggagccaatcacatcaggttatatccagcaactctgaacgtgacgg
A0A1S6ELT2_E1B19K-      --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------

A0A482EVC6_E1B19K-      agcagctgcgcacggaccatcagatgttgtcgtgtcttcgcaccgactac
A0A1S6ELT2_E1B19K-      ------------tggatcctcaaacggaattg------------------
A0A3G4W995_E1B19K-      ------------tggatcctcaaacggaattg------------------
A0A3G8W407_E1B19K-      ------------tggatcctcaaacggaattg------------------
F4ZCJ8_E1B19K-01        ------------tggatcctcaaacggaattg------------------
B5SNR1_E1B19K-01        ------------tggatcctcaaacggaattg------------------
P10544_E1B19K-01        ------------tggatcctcaaacggaattg------------------
A0A482EVC6_E1B19K-      ------------tggatcctcaaacggaattg------------------
W0S1G8_E1B19K-01        ------------tggatcctcaaacggaattg------------------
                                     *** * *** * *   * *                  

A0A482EVC6_E1B19K-      gaatccagcgatgaggattaa
A0A1S6ELT2_E1B19K-      ------------------taa
A0A3G4W995_E1B19K-      ------------------taa
A0A3G8W407_E1B19K-      ------------------taa
F4ZCJ8_E1B19K-01        ------------------taa
B5SNR1_E1B19K-01        ------------------taa
P10544_E1B19K-01        ------------------taa
A0A482EVC6_E1B19K-      ------------------taa
W0S1G8_E1B19K-01        ------------------taa

© 1998-2022Legal notice