Dataset for CDS adenoviridae of organism Human adenovirus A serotype 31

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5H2QAX5_E1B19K-      atggagctagaag------ctgtgttg-----------------------
D0Z5R9_E1B19K-01        atggagctagaag------ctgtgttg-----------------------
A0A5H2QAX5_E1B19K-      atggagcgagaggtcccacctgagctgggattacatgctggattacatga
                        ******* *** *      *** * **                       

A0A5H2QAX5_E1B19K-      caaagttttc--------------------agagcgttcgt---------
D0Z5R9_E1B19K-01        caaagttttc--------------------agagcgttcgt---------
A0A5H2QAX5_E1B19K-      caatgcatttgtggagggcatggctgaagaggagggtttgcatttactcg
                        *** *  **                      *** *** *          

A0A5H2QAX5_E1B19K-      ------cagcttct------------------------gcagtatacctc
D0Z5R9_E1B19K-01        ------cagcttct------------------------gcagtatacctc
A0A5H2QAX5_E1B19K-      ctggcgcggcctctaaccatgccgccgttgcaggaggagcagcagaacac
                              * ** ***                        **** * * * *

A0A5H2QAX5_E1B19K-      taa-----------aaac-----acttcaggtttttggaga---------
D0Z5R9_E1B19K-01        taa-----------aaac-----acttcaggtttttggaga---------
A0A5H2QAX5_E1B19K-      tacgacggaggagtaaacatggaaccacaggtgcaagaaggccatgaacc
                        **            ****     **  *****    * **          

A0A5H2QAX5_E1B19K-      ------------------tatctgtttggttct-----------------
D0Z5R9_E1B19K-01        ------------------tatctgtttggttct-----------------
A0A5H2QAX5_E1B19K-      tgaccccgacgaagggcctagttgtgcagttgttaaaaagcgggaaagaa
                                          **  ***   *** *                 

A0A5H2QAX5_E1B19K-      -----actttaagcaaggtggtac---atagggtga--------------
D0Z5R9_E1B19K-01        -----actttaagcaaggtggtac---atagggtga--------------
A0A5H2QAX5_E1B19K-      aagaaagtttaaaggaagctgtccttaataggctgactgttaacctaatg
                             * *****   * *  ** *   ***** ***              

A0A5H2QAX5_E1B19K-      -------------------------------aggaagattacagagagga
D0Z5R9_E1B19K-01        -------------------------------aggaagattacagagagga
A0A5H2QAX5_E1B19K-      tctcgcccgcgcttggaaactgtatattggcagga--attacag-gatga
                                                       ****  ******* ** **

A0A5H2QAX5_E1B19K-      att-----------------------------------------------
D0Z5R9_E1B19K-01        att-----------------------------------------------
A0A5H2QAX5_E1B19K-      atttaagcagggacacatgcatctacaatacaagtacagttttgagcagc

A0A5H2QAX5_E1B19K-      tgaaaacatattggcc-------------------gactgtcc----agg
D0Z5R9_E1B19K-01        tgaaaacatattggcc-------------------gactgtcc----agg
A0A5H2QAX5_E1B19K-      taaaaacccactggctagaaccatgggaggatttagagtgtgctattaaa
                        * *****  * ****                    ** *** *    *  

A0A5H2QAX5_E1B19K-      gcttttggcttcattagatctttgccaccactctgtttttcag-------
D0Z5R9_E1B19K-01        gcttttagcttcattagatctttgccaccactctgtttttcag-------
A0A5H2QAX5_E1B19K-      gctttt-gctaaagtagctttacgccctgactgtacttataaaatctcta
                        ****** ***  * *** * *  ***   *** *  ** * *        

A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      agacagtaactattacgtcatgtacgtacattataggcaatggagcagta

A0A5H2QAX5_E1B19K-      ------------------gaaagagtgg----------------------
D0Z5R9_E1B19K-01        ------------------gaaagagtgg----------------------
A0A5H2QAX5_E1B19K-      gttgaggtggacactagtgatagagttgcttttaggtgccgtatgcaggg
                                          ** ***** *                      

A0A5H2QAX5_E1B19K-      --------------------------------tcagatctttagattttt
D0Z5R9_E1B19K-01        --------------------------------tcagatctttagattttt
A0A5H2QAX5_E1B19K-      catgggtccgggggtggtaggtttggatggcattacatttatgaatgtta
                                                        * * ** * *  ** ** 

A0A5H2QAX5_E1B19K-      catcttctgg----------------------------------------
D0Z5R9_E1B19K-01        catcttctgg----------------------------------------
A0A5H2QAX5_E1B19K-      ggtttgctggagaaaaatttaagggcattatgtttgaggctaacacaagt
                          * * ****                                        

A0A5H2QAX5_E1B19K-      ------------------------ccgaac--------------------
D0Z5R9_E1B19K-01        ------------------------ccgaac--------------------
A0A5H2QAX5_E1B19K-      gttgtgttgcatggtgtgtactttcttaactttaataacacgtgtgtaga
                                                *  ***                    

A0A5H2QAX5_E1B19K-      -------------------------ggttgc---ttctat----------
D0Z5R9_E1B19K-01        -------------------------ggttgc---ttctat----------
A0A5H2QAX5_E1B19K-      gtgttggaataaggtttctgccaggggttgcactttttatgggtgttgga
                                                 ******   ** ***          

A0A5H2QAX5_E1B19K-      --------------------------------------------tgcctt
D0Z5R9_E1B19K-01        --------------------------------------------tgcctt
A0A5H2QAX5_E1B19K-      aggccttggtaggtaggcccaaaagtaaaatgtctgtaaaaaagtgcttg
                                                                    *** * 

A0A5H2QAX5_E1B19K-      tttggcaaccgtg------------ttggataaatgga------------
D0Z5R9_E1B19K-01        tttggcaaccgtg------------ttggataaatgga------------
A0A5H2QAX5_E1B19K-      tttgagaaatgcgtgcttgctttaattgtagaaggggatgcacacattag
                        ****  **  * *            *** * **  ***            

A0A5H2QAX5_E1B19K-      --------------------------------------------------
D0Z5R9_E1B19K-01        --------------------------------------------------
A0A5H2QAX5_E1B19K-      acataatgcagcttcagaaaatacctgttttattctactgaagggaatgg

A0A5H2QAX5_E1B19K-      ------------------------gcgagaggtc----------------
D0Z5R9_E1B19K-01        ------------------------gcgagaggtc----------------
A0A5H2QAX5_E1B19K-      ctattttaaagcacaatatggtttgcggggtgtctgatcagacaatgcga
                                                *** *  ***                

A0A5H2QAX5_E1B19K-      -------ccacctgagct----gggatta---------------------
D0Z5R9_E1B19K-01        -------ccacctgagct----gggatta---------------------
A0A5H2QAX5_E1B19K-      cggtttgtcacctgtgctgatggaaattgtcacactttgaaaactgttca
                                ****** ***    *  ***                      

A0A5H2QAX5_E1B19K-      ----------catgctgg-----------------------attacatg-
D0Z5R9_E1B19K-01        ----------catgctgg-----------------------attacatg-
A0A5H2QAX5_E1B19K-      tattgtgagtcatgctagatattgttggcctgtgtgtgaccataacatgt
                                  ****** *                       ** ***** 

A0A5H2QAX5_E1B19K-      -----------acaatgcatttg---------------------------
D0Z5R9_E1B19K-01        -----------gcaatgcatttg---------------------------
A0A5H2QAX5_E1B19K-      ttatgcgctgcacaatacatttgggtctccggcggggtgtgtttagacct
                                    **** ******                           

A0A5H2QAX5_E1B19K-      ----------------------------------tggag-----ggcat-
D0Z5R9_E1B19K-01        ----------------------------------tggag-----ggcat-
A0A5H2QAX5_E1B19K-      tcccaatgtaactttagtcattcaaatgttttgttggagcccgaggcgtt
                                                          *****     *** * 

A0A5H2QAX5_E1B19K-      ----------ggctgaagaggagggtttgcatttactcgc----------
D0Z5R9_E1B19K-01        ----------ggctgaagaggagggtttgcatttactcgc----------
A0A5H2QAX5_E1B19K-      ttccagagtgagtttaaatggggtgtttg-atttatctgtggaattatgc
                                   * * **  ** * ***** *****   *           

A0A5H2QAX5_E1B19K-      -----------------tggcgcggcctctaacca-tgccgccgttgcag
D0Z5R9_E1B19K-01        -----------------tggcgcggcctctaacca-tgccgccgttgcag
A0A5H2QAX5_E1B19K-      aagattatcaggtatgacgacgctgcccgtcatcgctgtcggcagtgcga
                                          * *** ***  * * *  ** ** *  ***  

A0A5H2QAX5_E1B19K-      gaggagcagcag------aacactacg-------------------acgg
D0Z5R9_E1B19K-01        gaggagcagcag------aacactacg-------------------acgg
A0A5H2QAX5_E1B19K-      atgtggcagtagtcatctagaacttcgccccgtcatgctgaatgtaactg
                          *  **** **      *  *** **                   ** *

A0A5H2QAX5_E1B19K-      aggag---------------------------------------------
D0Z5R9_E1B19K-01        aggag---------------------------------------------
A0A5H2QAX5_E1B19K-      aggagctgagaagtgaccatcttaccctgtcttgtctgcgaaccgactat

A0A5H2QAX5_E1B19K-      ---------------------taa
D0Z5R9_E1B19K-01        ---------------------taa
A0A5H2QAX5_E1B19K-      gattctagcgatgaagacaactaa

© 1998-2022Legal notice