Dataset for CDS E1B19K of organism Human adenovirus 21a

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A075IQ70_E1B19K-      atgga-----------------------------ggtttgggct------
A0A075IQ70_E1B19K-      atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
                        *****                             * *****  *      

A0A075IQ70_E1B19K-      ----------------atcttggaagacctgaaacagactaggctactgc
A0A075IQ70_E1B19K-      cagcagctttgtggagaacatggaaggctcgca--ggatgaggacaatct
                                        * * ****** *  * *   **  ***  * *  

A0A075IQ70_E1B19K-      tagaaaac-----------gcctcggacggagtctctggcttttggaga-
A0A075IQ70_E1B19K-      tagattactggccagtgcagcctctg--ggagtagcagggatactgagac
                        ****  **           ***** *  *****  * **  *   **** 

A0A075IQ70_E1B19K-      ---------------------ttctgg-----------------------
A0A075IQ70_E1B19K-      acccaccggccatgccagcggttctggaggaggagcagcaggaggacaat

A0A075IQ70_E1B19K-      --------------------ttcggtggtgatctagcta-----------
A0A075IQ70_E1B19K-      ccgagagccggcctggaccctccggtggaggagtagctgacctgtttcct
                                            * ****** *   *****            

A0A075IQ70_E1B19K-      -------ggctagtgttta-----------------ggataaaacagga-
A0A075IQ70_E1B19K-      gaactgcgacgggtgcttactaggtctacgtccagtggacaggacagggg
                               * *  *** ***                 *** *  *****  

A0A075IQ70_E1B19K-      --------------------ctacagggaagaatttgaaaagtta-ttgg
A0A075IQ70_E1B19K-      cattaagagggagaggaatcctagtgggaataattcaagaaccgagttgg
                                            ***  ***** ****  * **   * ****

A0A075IQ70_E1B19K-      acgacagtcca---------ggactttttgaagctctt------------
A0A075IQ70_E1B19K-      ctttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgag
                             ***  *          * * *  **** ** **            

A0A075IQ70_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      gttcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattc

A0A075IQ70_E1B19K-      -----------------------------aacttg---------------
A0A075IQ70_E1B19K-      actagaacaacttaagacctgttggttggaacctgaggatgattgggaag
                                                     *** **               

A0A075IQ70_E1B19K-      -ggccatcagg-ctcattttaag---------------------------
A0A075IQ70_E1B19K-      tggccattaggaattatgctaagatatctctgaggcctgataaacagtat
                         ****** ***  * **  ****                           

A0A075IQ70_E1B19K-      ---------gagaaggt---------------------------------
A0A075IQ70_E1B19K-      agaattactaagaagattaatattagaaatgcatgctacatatcagggaa
                                  ***** *                                 

A0A075IQ70_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      cggggcagaggttataatagatacccaagataaaacagcttttagatgtt

A0A075IQ70_E1B19K-      -----------------------------------------------ttt
A0A075IQ70_E1B19K-      gtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacattt

A0A075IQ70_E1B19K-      atcagttttagattt----------------------ttctactcctgg-
A0A075IQ70_E1B19K-      atgaatattaggtttaaaggggatgggtataatggcattgtatttatggc
                        ** * * **** ***                      ** ** *  *** 

A0A075IQ70_E1B19K-      tagaact--gctgct--------gctgtagcttttct-----------ta
A0A075IQ70_E1B19K-      taacactaagctgattctacatggttgtagcttgtttgggtttaataata
                        **  ***  **** *        * ******** * *           **

A0A075IQ70_E1B19K-      ctttt---------------------------------------------
A0A075IQ70_E1B19K-      cttgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttat
                        *** *                                             

A0A075IQ70_E1B19K-      --------------------------------------------------
A0A075IQ70_E1B19K-      gcatgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaa

A0A075IQ70_E1B19K-      -------------------------------atattggataaat------
A0A075IQ70_E1B19K-      gaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaag
                                                       *** ** ** **       

A0A075IQ70_E1B19K-      ---ggatccgcc---------------aaac---ccacttcagc------
A0A075IQ70_E1B19K-      caagggtccgccactgcgcagctacagaaactggctgcttcattctaata
                           ** ******               ****   *  *****        

A0A075IQ70_E1B19K-      aagggatacg----------------------ttttggat-ttcatagca
A0A075IQ70_E1B19K-      aagggaaatgccagtgtgaagcataatatgatctgtggacattcgaatga
                        ****** * *                       * ****  ***  *  *

A0A075IQ70_E1B19K-      gcagctttg------------------tggagaacatggaag--------
A0A075IQ70_E1B19K-      gaggccttatcagatgctgacctgcgctggtggacattgcaatattcttg
                        *  ** **                   *** * **** * *         

A0A075IQ70_E1B19K-      -----------------------gctcgcagga-------------tgag
A0A075IQ70_E1B19K-      ctaccgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttgaa
                                               ** **** **             *** 

A0A075IQ70_E1B19K-      gacaatcttagatta-----------------------------------
A0A075IQ70_E1B19K-      cataatgt--gattaccaagtgcaccatgcacataggtggtcgcagggga
                         * *** *  *****                                   

A0A075IQ70_E1B19K-      ----------ctggccagtgca----------------------------
A0A075IQ70_E1B19K-      atgtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttgga
                                  **  ****** *                            

A0A075IQ70_E1B19K-      -------gcctc--------tgggagtagcagg-----------------
A0A075IQ70_E1B19K-      accagatgccttttccagagtgagcttaacaggaatctttgatatgaata
                               ****         ** *  ** ****                 

A0A075IQ70_E1B19K-      -------------gatactgagac-------------acccaccggccat
A0A075IQ70_E1B19K-      ttcaactatggaagatcctgagatatgatgacactaaaccgagggtgcgc
                                     *** ******              *** *  *  *  

A0A075IQ70_E1B19K-      gccagcggttctggaggagga-----------gcagcaggag--------
A0A075IQ70_E1B19K-      gcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgga
                        **  ***  *  *****                **** ** *        

A0A075IQ70_E1B19K-      -------gacaatccgagagccg--------------gcctggacc----
A0A075IQ70_E1B19K-      tgtgactgaagacctgagacccgatcatttggtgcttgcctgcactggag
                               **  * * **** ***              ***** **     

A0A075IQ70_E1B19K-      ----------ctccggtggaggag--------tag
A0A075IQ70_E1B19K-      cggagttcggttctagtggtgaagaaactgactaa
                                   **  **** * **        ** 

© 1998-2022Legal notice