Dataset for CDS E1B19K of organism Human adenovirus 21a

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A075IQ70_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 21a GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctgaaacagactaggctactgctagaaaacgcctcggacggagtctctggctt
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggccatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
ccacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccggccatgccagcggttctggag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|A0A075IQ70_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus 21a GN=E1B19K (length=1479 residues).
atggatccgccaaacccacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccggccatg
ccagcggttctggaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgtccagtggacaggacaggggcattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaagtggccattaggaattatgctaagatatctctgaggcctgataaacagtatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaacggggcagaggttataatagatacccaagataaaacagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacatttatgaatattaggtttaaaggggat
gggtataatggcattgtatttatggctaacactaagctgattctacatggttgtagcttgtttgggtttaataatacttg
tgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaaga
gtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaagggtccgccac
tgcgcagctacagaaactggctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtggacattc
gaatgagaggccttatcagatgctgacctgcgctggtggacattgcaatattcttgctaccgtgcatatcgtttcccatg
cacgcaagaaatggcctgtatttgaacataatgtgattaccaagtgcaccatgcacataggtggtcgcaggggaatgttt
atgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacaggaat
ctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgcatgcgaatgcggag
gcaagcatgctagattccagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgcttgcctgcact
ggagcggagttcggttctagtggtgaagaaactgactaa
© 1998-2022Legal notice