Dataset for CDS adenoviridae of organism Human adenovirus 21

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0B4SJH1_E1B19K-      atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
Q2KS85_E1B19K-02        atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
A0A0B4SJH1_E1B19K-      atgga-----------------------------ggtttgggct------
Q2KS85_E1B19K-01        atgga-----------------------------ggtttgggct------
                        *****                             * *****  *      

A0A0B4SJH1_E1B19K-      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
Q2KS85_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
A0A0B4SJH1_E1B19K-      ----------------atcttggaagacctg--------aaacagac-ta
Q2KS85_E1B19K-01        ----------------atcttggaagacctg--------agacagac-ta
                                        * * ****** *  *          ***  * **

A0A0B4SJH1_E1B19K-      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
Q2KS85_E1B19K-02        gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
A0A0B4SJH1_E1B19K-      ggctactgctagaaaacgcctcggacggagtctctggcttttggaga---
Q2KS85_E1B19K-01        ggctactgctagaaaacgcctcggacggagtctctggcttttggaga---
                        *  *****         ***** *  *****  * **  *   ****   

A0A0B4SJH1_E1B19K-      ccaccggccatgccagcggttctggaggaggagcagcaggaggacaatcc
Q2KS85_E1B19K-02        ccaccggccatgccagcggttctggaggaggagcagcaggaggacaatcc
A0A0B4SJH1_E1B19K-      -------------------ttctgg-------------------------
Q2KS85_E1B19K-01        -------------------ttctgg-------------------------
                                           ******                         

A0A0B4SJH1_E1B19K-      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
Q2KS85_E1B19K-02        gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
A0A0B4SJH1_E1B19K-      ------------------ttcggtggtgatctagcta-------------
Q2KS85_E1B19K-01        ------------------ttcggtggtgatctagcta-------------
                                          * ****** *   *****              

A0A0B4SJH1_E1B19K-      actgcgacgggtgcttactaggtctacgtccagtggacaggacaggggca
Q2KS85_E1B19K-02        actgcgacgggtgcttactaggtctacgtccagtggacaggacaggggca
A0A0B4SJH1_E1B19K-      -----ggctagtgttta-----------------ggataaaacagga---
Q2KS85_E1B19K-01        -----ggctagtgttta-----------------ggataaaacagga---
                             * *  *** ***                 *** *  *****    

A0A0B4SJH1_E1B19K-      ttaagagggagaggaatcctagtgggaataattcaagaaccgagttggct
Q2KS85_E1B19K-02        ttaagagggagaggaatcctagtgggaataattcaagaaccgagttggct
A0A0B4SJH1_E1B19K-      ------------------ctacagggaagaatttgaaaagtta-ttggac
Q2KS85_E1B19K-01        ------------------ctacagggaagaatttgaaaagtta-ttggac
                                          ***  ***** ****  * **   * ****  

A0A0B4SJH1_E1B19K-      ttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgaggt
Q2KS85_E1B19K-02        ttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgaggt
A0A0B4SJH1_E1B19K-      gacagtcca---------ggactttttgaagctctt--------------
Q2KS85_E1B19K-01        gacagtcca---------ggactttttgaagctctt--------------
                           ***  *          * * *  **** ** **              

A0A0B4SJH1_E1B19K-      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
Q2KS85_E1B19K-02        tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
A0A0B4SJH1_E1B19K-      --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
                                                                          

A0A0B4SJH1_E1B19K-      tagaacaacttaagacctgttggttggaacctgaggatgattgggaagtg
Q2KS85_E1B19K-02        tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
A0A0B4SJH1_E1B19K-      ---------------------------aacttg----------------g
Q2KS85_E1B19K-01        ---------------------------aacttg----------------g
                                                   *** **                *

A0A0B4SJH1_E1B19K-      gccattaggaattatgctaagatatctctgaggcctgataaacagtatag
Q2KS85_E1B19K-02        gccattaggaattatgctaagatatctctgaggcctgataaacagtatag
A0A0B4SJH1_E1B19K-      gccatcagg-ctcattttaag-----------------------------
Q2KS85_E1B19K-01        gccaccagg-ctcattttaag-----------------------------
                        ****  ***  * **  ****                             

A0A0B4SJH1_E1B19K-      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
Q2KS85_E1B19K-02        aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
A0A0B4SJH1_E1B19K-      -------gagaaggt-----------------------------------
Q2KS85_E1B19K-01        -------gagaaggt-----------------------------------
                                ***** *                                   

A0A0B4SJH1_E1B19K-      gggcagaggttataatagatacccaagataaaacagcttttagatgttgt
Q2KS85_E1B19K-02        gggcagaggttataatagatacccaagataaagcagcttttagatgttgt
A0A0B4SJH1_E1B19K-      --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
                                                                          

A0A0B4SJH1_E1B19K-      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacatttat
Q2KS85_E1B19K-02        atgatgggtatgtggccaggggttgtcggcatggaagcagtaacatttat
A0A0B4SJH1_E1B19K-      ---------------------------------------------tttat
Q2KS85_E1B19K-01        ---------------------------------------------tttat
                                                                     *****

A0A0B4SJH1_E1B19K-      gaatattaggtttaaaggggatgggtataatggcattgtatttatggcta
Q2KS85_E1B19K-02        gaatattaggtttaaaggggatgggtataatggcattgtatttatggcta
A0A0B4SJH1_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
Q2KS85_E1B19K-01        cagttttagattt----------------------ttctactcctgg-ta
                         * * **** ***                      ** ** *  *** **

A0A0B4SJH1_E1B19K-      acactaagctgattctacatggttgtagcttgtttgggtttaataatact
Q2KS85_E1B19K-02        acactaagctgattctacatggttgtagcttttttgggtttaataatact
A0A0B4SJH1_E1B19K-      gaact--gctgct--------gctgtagcttttct-----------tact
Q2KS85_E1B19K-01        gaact--gctgct--------gctgtagcttttct-----------tact
                          ***  **** *        * ******** * *           ****

A0A0B4SJH1_E1B19K-      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
Q2KS85_E1B19K-02        tgtgtagaagcttgggggcaagttggtgtgaggggttgtagtttttatgc
A0A0B4SJH1_E1B19K-      ttt-----------------------------------------------
Q2KS85_E1B19K-01        ttt-----------------------------------------------
                        * *                                               

A0A0B4SJH1_E1B19K-      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
Q2KS85_E1B19K-02        atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
A0A0B4SJH1_E1B19K-      --------------------------------------------------
Q2KS85_E1B19K-01        --------------------------------------------------
                                                                          

A0A0B4SJH1_E1B19K-      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
Q2KS85_E1B19K-02        aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
A0A0B4SJH1_E1B19K-      -----------------------------atattggataaat--------
Q2KS85_E1B19K-01        -----------------------------atattggataaat--------
                                                     *** ** ** **         

A0A0B4SJH1_E1B19K-      agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
Q2KS85_E1B19K-02        agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
A0A0B4SJH1_E1B19K-      -ggatccgcc---------------aaac---ccacttcagc------aa
Q2KS85_E1B19K-01        -ggatccgcc---------------aaac---ccacttcagc------aa
                         ** ******               ****   *  *****        **

A0A0B4SJH1_E1B19K-      gggaaatgccagtgtgaagcataatatgatctgtggacattcgaatgaga
Q2KS85_E1B19K-02        gggaaatgccagtgtgaagcataatatgatctgtggacattcgaatgaga
A0A0B4SJH1_E1B19K-      gggatacg----------------------ttttggat-ttcatagcagc
Q2KS85_E1B19K-01        gggatacg----------------------ttttggat-ttcatagcagc
                        **** * *                       * ****  ***  *  ** 

A0A0B4SJH1_E1B19K-      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
Q2KS85_E1B19K-02        ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
A0A0B4SJH1_E1B19K-      agctttg------------------tggagaacatggaag----------
Q2KS85_E1B19K-01        agctttg------------------tggagaacatggaag----------
                         ** **                   *** * **** * *           

A0A0B4SJH1_E1B19K-      accgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttgaaca
Q2KS85_E1B19K-02        accgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttgaaca
A0A0B4SJH1_E1B19K-      ---------------------gctcgcagga-------------tgagga
Q2KS85_E1B19K-01        ---------------------gctcgcagga-------------tgagga
                                             ** **** **             ***  *

A0A0B4SJH1_E1B19K-      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
Q2KS85_E1B19K-02        taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
A0A0B4SJH1_E1B19K-      caatcttagatta-------------------------------------
Q2KS85_E1B19K-01        caatcttagatta-------------------------------------
                         *** *  *****                                     

A0A0B4SJH1_E1B19K-      gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
Q2KS85_E1B19K-02        gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
A0A0B4SJH1_E1B19K-      --------ctggccagtgca------------------------------
Q2KS85_E1B19K-01        --------ctggccagtgca------------------------------
                                **  ****** *                              

A0A0B4SJH1_E1B19K-      cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
Q2KS85_E1B19K-02        cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
A0A0B4SJH1_E1B19K-      -----gcctc--------tgggagtagcagg-------------------
Q2KS85_E1B19K-01        -----gcctc--------tgggagtagcagg-------------------
                             ****         ** *  ** ****                   

A0A0B4SJH1_E1B19K-      caactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgc
Q2KS85_E1B19K-02        caactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgc
A0A0B4SJH1_E1B19K-      -----------gatactgagac-------------acccaccggccatgc
Q2KS85_E1B19K-01        -----------gatactgagac-------------acccaccggccatgc
                                   *** ******              *** *  *  *  **

A0A0B4SJH1_E1B19K-      atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
Q2KS85_E1B19K-02        atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
A0A0B4SJH1_E1B19K-      cagcggttctggaggagga-----------gcagcaggag----------
Q2KS85_E1B19K-01        cagcggttctggaggagga-----------gcagcaggag----------
                          ***  *  *****                **** ** *          

A0A0B4SJH1_E1B19K-      tgactgaagacctgagacccgatcatttggtgcttgcctgcactggagcg
Q2KS85_E1B19K-02        tgactgaagacctgagacccgatcatttggtgcttgcctgcactggagcg
A0A0B4SJH1_E1B19K-      -----gacaatccgagagccg--------------gcctggacc------
Q2KS85_E1B19K-01        -----gacaatccgagagccg--------------gcctggacc------
                             **  * * **** ***              ***** **       

A0A0B4SJH1_E1B19K-      gagttcggttctagtggtgaagaaactgactaa
Q2KS85_E1B19K-02        gagttcggttctagtggtgaagaaactgactaa
A0A0B4SJH1_E1B19K-      --------ctccggtggaggag--------tag
Q2KS85_E1B19K-01        --------ctccggtggaggag--------tag
                                 **  **** * **        ** 

© 1998-2022Legal notice