Dataset for CDS adenoviridae of organism Human adenovirus 21

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0B4SJH1_E1B19K-      atggaggtttgggctatcttggaagacctgaaacagactaggctactgct
Q2KS85_E1B19K-01        atggaggtttgggctatcttggaagacctgagacagactaggctactgct
                        ******************************* ******************

A0A0B4SJH1_E1B19K-      agaaaacgcctcggacggagtctctggcttttggagattctggttcggtg
Q2KS85_E1B19K-01        agaaaacgcctcggacggagtctctggcttttggagattctggttcggtg

A0A0B4SJH1_E1B19K-      gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
Q2KS85_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa

A0A0B4SJH1_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
Q2KS85_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt

A0A0B4SJH1_E1B19K-      gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
Q2KS85_E1B19K-01        gggccaccaggctcattttaaggagaaggttttatcagttttagattttt
                        ****** *******************************************

A0A0B4SJH1_E1B19K-      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
Q2KS85_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg

A0A0B4SJH1_E1B19K-      gataaatggatccgccaaacccacttcagcaagggatacgttttggattt
Q2KS85_E1B19K-01        gataaatggatccgccaaacccacttcagcaagggatacgttttggattt

A0A0B4SJH1_E1B19K-      catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
Q2KS85_E1B19K-01        catagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa

A0A0B4SJH1_E1B19K-      tcttagattactggccagtgcagcctctgggagtagcagggatactgaga
Q2KS85_E1B19K-01        tcttagattactggccagtgcagcctctgggagtagcagggatactgaga

A0A0B4SJH1_E1B19K-      cacccaccggccatgccagcggttctggaggaggagcagcaggaggacaa
Q2KS85_E1B19K-01        cacccaccggccatgccagcggttctggaggaggagcagcaggaggacaa

A0A0B4SJH1_E1B19K-      tccgagagccggcctggaccctccggtggaggagtag
Q2KS85_E1B19K-01        tccgagagccggcctggaccctccggtggaggagtag

© 1998-2020Legal notice