Dataset for CDS BMF of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A674GIP8_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A674GIP8_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A674GIP8_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct

A0A674GIP8_BMF-03      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A674GIP8_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A674GIP8_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg

A0A674GIP8_BMF-03      gtgagatgactgcaactggctttttcacacagaaccagtcctacagctgc
A0A674GIP8_BMF-01      gtgagatgactgcaactggctttttcacacagaaccagtcctacagctgc
A0A674GIP8_BMF-02      gtgagatgactgcaactggctttttcacacagaaccagtcctacagctgc

A0A674GIP8_BMF-03      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A674GIP8_BMF-01      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A674GIP8_BMF-02      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg

A0A674GIP8_BMF-03      tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A674GIP8_BMF-01      tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A674GIP8_BMF-02      tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat

A0A674GIP8_BMF-03      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagcca
A0A674GIP8_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagcca
A0A674GIP8_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagcca

A0A674GIP8_BMF-03      aggagactcttctatgggagtgctggttaccgtttacatgtccctccagc
A0A674GIP8_BMF-01      aggagactcttctatgggagtgctggttaccgtttacatgtccctccagc
A0A674GIP8_BMF-02      aggagactcttctatgggagtgctggttaccgtttacatgtccctccagc

A0A674GIP8_BMF-03      tgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc
A0A674GIP8_BMF-01      tgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc
A0A674GIP8_BMF-02      tgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc

A0A674GIP8_BMF-03      gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgcc
A0A674GIP8_BMF-01      gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgcc
A0A674GIP8_BMF-02      gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgcc

A0A674GIP8_BMF-03      gaccagttccaccggctccacattcagagg-gtaggcagaacagaaatca
A0A674GIP8_BMF-01      gaccagttccaccggctccacattcagaggcatcagcagaacagaaatca
A0A674GIP8_BMF-02      gaccagttccaccggctccacattcagag------gcagaacagaaatca
                       *****************************      ***************

A0A674GIP8_BMF-03      agtgtggtggcagctttttctcttcctacacaacttggccttaa------
A0A674GIP8_BMF-01      agtgtggtggcagctttttctcttcctacacaacttggccttaaacacgg
A0A674GIP8_BMF-02      agtgtggtggcagctttttctcttcctacacaacttggccttaaacacgg

A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      aggtgaacaggaaccacactgggcagagaaatcactggctttgtttaaaa
A0A674GIP8_BMF-02      aggtgaacaggaaccacactgggcagag---------------------g

A0A674GIP8_BMF-03      ---
A0A674GIP8_BMF-01      tag
A0A674GIP8_BMF-02      tga

© 1998-2021Legal notice