Dataset for CDS BMF of organism Taeniopygia guttata

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A674GIP8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Taeniopygia guttata GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccaaggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccaccggctccacattcagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagagaaatcactggctttgtttaaaatag
>gnl|bcl2dbcds|A0A674GIP8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Taeniopygia guttata GN=BMF (length=576 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccaaggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccaccggctccacattcagagg
cagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacaggaacca
cactgggcagaggtga
>gnl|bcl2dbcds|A0A674GIP8_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Taeniopygia guttata GN=BMF (length=543 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccaaggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctgggtttgtgttggatccgcacctccaggaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccaccggctccacattcagagg
gtaggcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaa
© 1998-2021Legal notice