Dataset for CDS BBC3 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcag
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      ---atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacc-
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      cccccccaccatggggggggcgtgtctcttggggccttctcacctgcctc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      tgcctgccacgtgtcctcatgcctgggttcaagagtggggtgccctgtgt
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      accccagggaggggggtgccctgggggccggcctgatgccccctgcactt
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgcc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      ---------------------------tgtcacaggccccagggagcgcc
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A480SCP6_BBC3-01      -----------------------------gcgagagtcagtgcaggggct
A0A4X1VVX9_BBC3-01      -----------------------------gcgagagtcagtgcaggggct
A0A480SCP6_BBC3-04      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
A0A4X1VVX9_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
A0A480SCP6_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
A0A480SCP6_BBC3-03      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
                                                      *  *** * **  **** **

A0A480SCP6_BBC3-01      -gcccgggcatgtccgtgcc------------------------------
A0A4X1VVX9_BBC3-01      -gcccgggcatgtccgtgcc------------------------------
A0A480SCP6_BBC3-04      ggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
A0A4X1VVX9_BBC3-02      ggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
A0A480SCP6_BBC3-02      ggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
A0A480SCP6_BBC3-03      ggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
                         ***** *   * *** * *                              

A0A480SCP6_BBC3-01      cagtgcccagggctttctgctcacc--------------------ctggc
A0A4X1VVX9_BBC3-01      cagtgcccagggctttctgctcacc--------------------ctggc
A0A480SCP6_BBC3-04      ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcc
A0A4X1VVX9_BBC3-02      ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcc
A0A480SCP6_BBC3-02      ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcc
A0A480SCP6_BBC3-03      ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcc
                        * *** ** * *   *****  ***                    * * *

A0A480SCP6_BBC3-01      cccacc--------------------------------------------
A0A4X1VVX9_BBC3-01      cccacc--------------------------------------------
A0A480SCP6_BBC3-04      cccaccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
A0A4X1VVX9_BBC3-02      cccaccctgctgcccgctgcctacctctgcgccaccgcc------cccgc
A0A480SCP6_BBC3-02      cccaccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
A0A480SCP6_BBC3-03      cccaccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
                        ******                                            

A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
A0A4X1VVX9_BBC3-02      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
A0A480SCP6_BBC3-02      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
A0A480SCP6_BBC3-03      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
                                                                          

A0A480SCP6_BBC3-01      -------agattc--------atggtcctcagccctcactctcgccggcg
A0A4X1VVX9_BBC3-01      -------agattc--------atggtcctcagccctcactctcgccggcg
A0A480SCP6_BBC3-04      ggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
A0A4X1VVX9_BBC3-02      ggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
A0A480SCP6_BBC3-02      ggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
A0A480SCP6_BBC3-03      ggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
                               **   *        * ***************************

A0A480SCP6_BBC3-01      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A4X1VVX9_BBC3-01      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A480SCP6_BBC3-04      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A4X1VVX9_BBC3-02      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A480SCP6_BBC3-02      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A480SCP6_BBC3-03      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
                        **************************************************

A0A480SCP6_BBC3-01      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
A0A4X1VVX9_BBC3-01      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
A0A480SCP6_BBC3-04      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
A0A4X1VVX9_BBC3-02      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
A0A480SCP6_BBC3-02      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
A0A480SCP6_BBC3-03      cggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
                        **************************************************

A0A480SCP6_BBC3-01      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
A0A4X1VVX9_BBC3-01      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
A0A480SCP6_BBC3-04      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
A0A4X1VVX9_BBC3-02      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
A0A480SCP6_BBC3-02      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
A0A480SCP6_BBC3-03      cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcg
                        **************************************************

A0A480SCP6_BBC3-01      ctgtacgagcggcgg--------------------agaca----------
A0A4X1VVX9_BBC3-01      ctgtacgagcggcgg--------------------agaca----------
A0A480SCP6_BBC3-04      ctgtacgagcggcgggtgagtgctgggggaggggtagacggcaggtggga
A0A4X1VVX9_BBC3-02      ctgtacgagcggcgg--------------------agaca----------
A0A480SCP6_BBC3-02      ctgtacgagcggcgg--------------------agaca----------
A0A480SCP6_BBC3-03      ctgtacgagcggcgg--------------------agaca----------
                        ***************                    ****           

A0A480SCP6_BBC3-01      -----------------------------------agaggagcagcagcg
A0A4X1VVX9_BBC3-01      -----------------------------------agaggagcagcagcg
A0A480SCP6_BBC3-04      cttcccgcggggagggggttgggggcgacccagccagatgtgcggcagc-
A0A4X1VVX9_BBC3-02      -----------------------------------agaggagcagcagcg
A0A480SCP6_BBC3-02      -----------------------------------agaggagcagcagcg
A0A480SCP6_BBC3-03      -----------------------------------agaggagcagcagcg
                                                           *** * ** ***** 

A0A480SCP6_BBC3-01      acaccgcccc-----------tcgccctggagg-----------------
A0A4X1VVX9_BBC3-01      acaccgcccc-----------tcgccctggagg-----------------
A0A480SCP6_BBC3-04      -tgctgccctgcgcggcggggtcgcgctggggacaggcaggtgggagggg
A0A4X1VVX9_BBC3-02      acaccgcccc-----------tcgccctggagg-----------------
A0A480SCP6_BBC3-02      acaccgcccc-----------tcgccctggagg-----------------
A0A480SCP6_BBC3-03      acaccgcccc-----------tcgccctggagg-----------------
                           * ****            **** **** *                  

A0A480SCP6_BBC3-01      -gttctgt------------------------------------acaatc
A0A4X1VVX9_BBC3-01      -gttctgt------------------------------------acaatc
A0A480SCP6_BBC3-04      cggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccacc
A0A4X1VVX9_BBC3-02      -gttctgt------------------------------------acaatc
A0A480SCP6_BBC3-02      -gttctgt------------------------------------acaatc
A0A480SCP6_BBC3-03      -gttctgt------------------------------------acaatc
                         *  ****                                    ** * *

A0A480SCP6_BBC3-01      tcatcatgggac---------------------------ttctgccctta
A0A4X1VVX9_BBC3-01      tcatcatgggac---------------------------ttctgccctta
A0A480SCP6_BBC3-04      gggtcgagggccagggccggggcagcctcgagcgttacggtgtgcccgcg
A0A4X1VVX9_BBC3-02      tcatcatgggac---------------------------ttctgccctta
A0A480SCP6_BBC3-02      tcatcatgggac---------------------------ttctgccctta
A0A480SCP6_BBC3-03      tcatcatgggac---------------------------ttctgccctta
                           **  *** *                            * *****   

A0A480SCP6_BBC3-01      cccaggggccg-----tggagcccccgaga--------tggagc------
A0A4X1VVX9_BBC3-01      cccaggggccg-----tggagcccccgaga--------tggagc------
A0A480SCP6_BBC3-04      gccggcggccggcggccggcggccgcgagaactgagggcggcgctcagcc
A0A4X1VVX9_BBC3-02      cccaggggccg-----tggagcccccgaga--------tggagc------
A0A480SCP6_BBC3-02      cccaggggccg-----tggagcccccgaga--------tggagc------
A0A480SCP6_BBC3-03      cccaggggccg-----tggagcccccgaga--------tggagc------
                         ** * *****      ** * ** *****         ** **      

A0A480SCP6_BBC3-01      ---------------------ctaattag---------
A0A4X1VVX9_BBC3-01      ---------------------ctaattag---------
A0A480SCP6_BBC3-04      gagcggctcatatatcccaggctatttatagccggtga
A0A4X1VVX9_BBC3-02      ---------------------ctaattag---------
A0A480SCP6_BBC3-02      ---------------------ctaattag---------
A0A480SCP6_BBC3-03      ---------------------ctaattag---------
                                             *** ***          

© 1998-2022Legal notice