Dataset for CDS BBC3 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|F1RM01_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=393 residues).
gcgagagtcagtgcaggggctgcccgggcatgtccgtgcccagtgcccagggctttctgctcaccctggccccaccagat
tcatggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgg
gcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
tctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatggagcctaattag
>gnl|bcl2dbcds|F1RM01_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=1086 residues).
atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagcccccccaccatggggggggcgtgtctctt
ggggccttctcacctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgcctgccac
gtgtcctcatgcctgggttcaagagtggggtgccctgtgtaccccagggaggggggtgccctgggggccggcctgatgcc
ccctgcacttctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgccatggcccgagcacgccagga
gggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgagg
cccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccggggg
ccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgggtgagtgctgggggaggggtagacggcaggtggga
cttcccgcggggagggggttgggggcgacccagccagatgtgcggcagctgctgccctgcgcggcggggtcgcgctgggg
acaggcaggtgggaggggcggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcgagggcc
agggccggggcagcctcgagcgttacggtgtgcccgcggccggcggccggcggccggcggccgcgagaactgagggcggc
gctcagccgagcggctcatatatcccaggctatttatagccggtga
>gnl|bcl2dbcds|F1RM01_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
>gnl|bcl2dbcds|F1RM01_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=651 residues).
atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacctgtcacaggccccagggagcgccatggcccgagc
acgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctgg
tgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcc
tacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccg
gccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcg
ctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatc
ggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccg
cccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatgg
agcctaattag
© 1998-2020Legal notice