Dataset for CDS BBC3 of organism Suricata suricatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673UKJ9_BBC3-01      atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggc
A0A673UKJ9_BBC3-02      atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggc
                        **************************************************

A0A673UKJ9_BBC3-01      ttccttagtgccccgggtgccccgtcagatttgtggtcctcagccctcac
A0A673UKJ9_BBC3-02      ttccttagtgccccgggtgccccgtcagatttgt----------------
                        **********************************                

A0A673UKJ9_BBC3-01      tctcgccggcggagccacacctggaatcgccggtgcccagcgccccgggg
A0A673UKJ9_BBC3-02      --------------------------------------------------
                                                                          

A0A673UKJ9_BBC3-01      gccctggcgggcggccccacccaggcagccccgggaatccggggggagga
A0A673UKJ9_BBC3-02      --------------------------------------------------
                                                                          

A0A673UKJ9_BBC3-01      agagcagtgggcccgggagatcggggcccagctgcggcggatggcggacg
A0A673UKJ9_BBC3-02      --------------------------------------------------
                                                                          

A0A673UKJ9_BBC3-01      acctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacac
A0A673UKJ9_BBC3-02      -------------------------gagacaagaggagcagcagcgacac
                                                 *************************

A0A673UKJ9_BBC3-01      cgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcc
A0A673UKJ9_BBC3-02      cgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcc
                        **************************************************

A0A673UKJ9_BBC3-01      cttacccagggcccgcggagccccggagatggagcccaattag-------
A0A673UKJ9_BBC3-02      cttacccagggcccgcggagccccggagatggagcccaattaggtgcctg
                        *******************************************       

A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A673UKJ9_BBC3-02      cacccgcccggtggacgtcggggacttggggggcaggaccctcccgcctc
                                                                          

A0A673UKJ9_BBC3-01      --------------------------------------------
A0A673UKJ9_BBC3-02      ctgacgccctggccagcgcgggggacttcttctgcaccatgtag
                                                                    

© 1998-2020Legal notice