Dataset for CDS BBC3 of organism Suricata suricatta

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A673UKJ9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Suricata suricatta GN=BBC3 (length=393 residues).
atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggcttccttagtgccccgggtgccccgtcagat
ttgtggtcctcagccctcactctcgccggcggagccacacctggaatcgccggtgcccagcgccccgggggccctggcgg
gcggccccacccaggcagccccgggaatccggggggaggaagagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgcccttacccagggcccgcggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A673UKJ9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Suricata suricatta GN=BBC3 (length=303 residues).
atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggcttccttagtgccccgggtgccccgtcagat
ttgtgagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccc
ttacccagggcccgcggagccccggagatggagcccaattaggtgcctgcacccgcccggtggacgtcggggacttgggg
ggcaggaccctcccgcctcctgacgccctggccagcgcgggggacttcttctgcaccatgtag
© 1998-2020Legal notice