Dataset for CDS classical BH3-containing proteins of organism Strigops habroptila

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672V891_BMF-01       atgg---atcgccccagctacctggaagaggactattctagcctggatgg
A0A672TST9_BCL2L11      atggccaagcagccccccgaggt--gaaggcgc------aacgcgacggc
A0A672V9F8_BAD-01       atgg---ggggtccgtgtgaggttgtggggtgc------agccc------
                        ****        **     *  *      *  *      * *        

A0A672V891_BMF-01       gctggacgatgatgtgtttcactctgatgactttggacttgcaggtcagc
A0A672TST9_BCL2L11      gacggcggg----------------gagggcccgggcccggccgcgcaac
A0A672V9F8_BAD-01       -----------------------------ccccgtgccccccagcgccgc
                                                      *    * *   * *  *  *

A0A672V891_BMF-01       ctggtgagatgactgcaactggcattttcacacagaa-----------cc
A0A672TST9_BCL2L11      tg-----------cgc-cccggcgctcccgcag---------ccctgccc
A0A672V9F8_BAD-01       ca-----------tgagcccggctcccccggcggggggtgtccccccccc
                                      *   * ***     *                   **

A0A672V891_BMF-01       agtcctacagctgccttc-tggggaggtttcaact------attccccct
A0A672TST9_BCL2L11      ggctccgccgccaccgccacggcggggcctccgccgcggggcccccccgc
A0A672V9F8_BAD-01       ggcccccccgcggc-----aggtgagacccgcccc------ccccccccc
                         *  *  * **  *      ** * *       *          ****  

A0A672V891_BMF-01       ca-------------cacactgctgtggtcccggt--atcaggcatcctg
A0A672TST9_BCL2L11      cagccccgggcccttcgccacacggtcgccgctgttcat----cttcgtg
A0A672V9F8_BAD-01       cagcc----------cgttatggggttgtccccgccccccgtgctttgtg
                        **             *        ** * * * *         * *  **

A0A672V891_BMF-01       agcagca------------ggacaaggcaac--tcaaacactcagcccat
A0A672TST9_BCL2L11      cgga---------------ggtcgccgctgctgtc---------gcgctc
A0A672V9F8_BAD-01       ggggggggggttcaggcgcgggcgcggctggggtcagagggggaacgcgg
                         *                 ** *   **     **          * *  

A0A672V891_BMF-01       cctcttccag----tcaggatgttatgttgccttgtggagtcactgaaga
A0A672TST9_BCL2L11      ctccagcgggtacttctc----gttcgacgccgagcgcagcccc----gc
A0A672V9F8_BAD-01       ccccggggagccccccccgggggtccggggccggtcgc-gctcc----gc
                        *  *     *     *       *  *  ***    *  *   *    * 

A0A672V891_BMF-01       gccccggagactcttctatgggaatgctggttacc-----gtttacacat
A0A672TST9_BCL2L11      gcccctca-gctgcgataaggccacgcagacccccagcccgccctgccag
A0A672V9F8_BAD-01       cccccccgcgctctg----ggcggcgcgaaggttcgggcgg---------
                         ****     **       **    **       *     *         

A0A672V891_BMF-01       ccctccagtcg-----gctttgcgttggatccacacctccaagaggagc-
A0A672TST9_BCL2L11      gctctcagccactgcctcagcgccatggcttc------ccggtggcagt-
A0A672V9F8_BAD-01       -----cagctgaggaggatgagcgatgagttccagcagcaggtgggggtg
                             ***             **  **  * *      *     *  *  

A0A672V891_BMF-01       ctcaggaaggtcagcgggaag-cgcgtgcc-gaggtgcagattgc-acgg
A0A672TST9_BCL2L11      ctccctcgcg--agcagaagacctccagcctgaaatctggattgc-ccag
A0A672V9F8_BAD-01       ctgccgcgcgccagcag-----cgcggggggggcgggggggtggcgcgag
                        **       *  *** *     * *  *   *       * * **    *

A0A672V891_BMF-01       aagttgcagtgcattgctgaccagttccaccggctccacatgcagaggca
A0A672TST9_BCL2L11      gagctgcggcgcattggagacgagttcaatgcctcctat-------tgtc
A0A672V9F8_BAD-01       gtgctgaggagc--tggtggggggccccgcccccccccc-------ggcc
                          * **  * **  **  *    *  *        *           *  

A0A672V891_BMF-01       tcagcagaacagaaatcaagtgtggtggcagct-ttttctcttcctacac
A0A672TST9_BCL2L11      ccagacgg--gtaactttcacct--ttgta----ctttccatttctttac
A0A672V9F8_BAD-01       ccgccccgccgcgacccccccat--tgacagcccccccccgggtcccc-c
                         *           *        *  *   *        *     *    *

A0A672V891_BMF-01       aacttggccttaaacgcggagg---------tgaacaggaaccacactgg
A0A672TST9_BCL2L11      acccagtctctaaaagggaaaagcttaatcatctctggaaactgcctct-
A0A672V9F8_BAD-01       ccccacgcttcggggggggggggccacgt--tttagggggggtg----g-
                          *    *       * *             *     *            

A0A672V891_BMF-01       gcagaggtga
A0A672TST9_BCL2L11      ---gcggtga
A0A672V9F8_BAD-01       ---gcaataa
                           *   * *

© 1998-2020Legal notice