Dataset for CDS classical BH3-containing proteins of organism Strigops habroptila

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A672TST9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Strigops habroptila GN=BCL2L11 (length=549 residues).
atggccaagcagccccccgaggtgaaggcgcaacgcgacggcgacggcggggagggcccgggcccggccgcgcaactgcg
ccccggcgctcccgcagccctgcccggctccgccgccaccgccacggcggggcctccgccgcggggcccccccgccagcc
ccgggcccttcgccacacggtcgccgctgttcatcttcgtgcggaggtcgccgctgctgtcgcgctcctccagcgggtac
ttctcgttcgacgccgagcgcagccccgcgcccctcagctgcgataaggccacgcagacccccagcccgccctgccaggc
tctcagccactgcctcagcgccatggcttcccggtggcagtctccctcgcgagcagaagacctccagcctgaaatctgga
ttgcccaggagctgcggcgcattggagacgagttcaatgcctcctattgtcccagacgggtaactttcacctttgtactt
tccatttctttacacccagtctctaaaagggaaaagcttaatcatctctggaaactgcctctgcggtga
>gnl|bcl2dbcds|A0A672V891_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Strigops habroptila GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgatgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacatccctccagtcggctttgcgttggatccacacctccaagaggagcctcaggaaggtcagc
gggaagcgcgtgccgaggtgcagattgcacggaagttgcagtgcattgctgaccagttccaccggctccacatgcagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacgcggaggtgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A672V9F8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Strigops habroptila GN=BAD (length=534 residues).
atggggggtccgtgtgaggttgtggggtgcagcccccccgtgccccccagcgccgccatgagcccggctcccccggcggg
gggtgtcccccccccggcccccccgcggcaggtgagacccgccccccccccccccagcccgttatggggttgtccccgcc
ccccgtgctttgtgggggggggggttcaggcgcgggcgcggctggggtcagagggggaacgcggccccggggagcccccc
ccgggggtccggggccggtcgcgctccgccccccccgcgctctgggcggcgcgaaggttcgggcggcagctgaggaggat
gagcgatgagttccagcagcaggtgggggtgctgccgcgcgccagcagcgcggggggggcgggggggtggcgcgaggtgc
tgaggagctggtggggggccccgccccccccccggccccgccccgccgcgacccccccattgacagcccccccccgggtc
ccccccccacgcttcggggggggggggccacgttttagggggggtgggcaataa
© 1998-2020Legal notice