Dataset for CDS BCL2L11 of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672L1R2_BCL2L11      atgtctgacacgtc---cagagagcaaacgccgggccggggaagcggaga
A0A672PQD1_BCL2L11      atgtccgacacgtccagcagagagcaaacgccgggccggggaagcggaga
                        ***** ********   *********************************

A0A672L1R2_BCL2L11      gagcgccggtggcgcagccgtcttaggctccgggcactttgacttccctc
A0A672PQD1_BCL2L11      gagcgccggtggcgcagccgtcttaggctccgggcactttgacttccctc
                        **************************************************

A0A672L1R2_BCL2L11      agccgagcgatggggacccgttaaggggagggattgccatgtcgagtagt
A0A672PQD1_BCL2L11      agccgagcgatggggacccgttaaggggagggattgccatgtcgagtagt
                        **************************************************

A0A672L1R2_BCL2L11      caccagtcgaggtcaccgatgtcccgaaccttctccaggtcctctagtgg
A0A672PQD1_BCL2L11      caccagtcgaggtcaccgatgtgccggaccttctccaggtcctctagtgg
                        ********************** *** ***********************

A0A672L1R2_BCL2L11      ctatttttccgtcgacagcgattctgtgccaagttccccgctaatgccca
A0A672PQD1_BCL2L11      ctatttttccgtcgacagcgattctgtgccaggttccccgctaatgccca
                        ******************************* ******************

A0A672L1R2_BCL2L11      atatttccgaagcgcaagacggccaaaatgatgaggtatggtctgccgaa
A0A672PQD1_BCL2L11      atatttccgaagcgcaagacggcccaaatgatgaggtatggtttgccgaa
                        ************************ ***************** *******

A0A672L1R2_BCL2L11      cctagccaccagcacgtgcagatggcagcacctgtcggagccatggggcc
A0A672PQD1_BCL2L11      cctagccaccagcacgcacagatggcggcacctgtgggagccatggggcc
                        ****************  ******** ******** **************

A0A672L1R2_BCL2L11      ggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
A0A672PQD1_BCL2L11      ggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
                        **************************************************

A0A672L1R2_BCL2L11      gtctgtactgtcagggggccggtgcaggcgggaacaacgcggcccagctg
A0A672PQD1_BCL2L11      gcctgtactgtcagggggccggtgcaggtgggaacaacggggcccagctg
                        * ************************** ********** **********

A0A672L1R2_BCL2L11      cgcgctcccaacgaacacgccatcatcatgtggatgaacgaccttatcgg
A0A672PQD1_BCL2L11      cacgctcccaacgaacacgccatcatcatgtggatgaacgaccttatcgg
                        * ************************************************

A0A672L1R2_BCL2L11      acgtgtagtacagtttttcctgcgaaggagatga
A0A672PQD1_BCL2L11      acgtgtagtacagtttttcctgcgaagaagatga
                        *************************** ******

© 1998-2020Legal notice