Dataset for CDS BCL2L11 of organism Sinocyclocheilus grahami

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A672L1R2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctccgg
gcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcgaggt
caccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaagttccccgcta
atgcccaatatttccgaagcgcaagacggccaaaatgatgaggtatggtctgccgaacctagccaccagcacgtgcagat
ggcagcacctgtcggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaaccgtc
tgtactgtcagggggccggtgcaggcgggaacaacgcggcccagctgcgcgctcccaacgaacacgccatcatcatgtgg
atgaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
>gnl|bcl2dbcds|A0A672PQD1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L11 (length=534 residues).
atgtccgacacgtccagcagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctc
cgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcga
ggtcaccgatgtgccggaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaggttccccg
ctaatgcccaatatttccgaagcgcaagacggcccaaatgatgaggtatggtttgccgaacctagccaccagcacgcaca
gatggcggcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
gcctgtactgtcagggggccggtgcaggtgggaacaacggggcccagctgcacgctcccaacgaacacgccatcatcatg
tggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaagaagatga
© 1998-2020Legal notice