Dataset for CDS BMF of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A671M0H4_BMF-01      atggatgaggatgaggatgatgtgcgcaggaagggtctacagcgctggcc
A0A671M0H4_BMF-02      atggatgaggatgaggatgatgtgcgcaggaagggtctacagcgctggcc
A0A671MNR9_BMF-01      atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggcc
                       ******************************************* ******

A0A671M0H4_BMF-01      ttcctcccgcgttcagataaagcagaccgagacagcagggacaccccctg
A0A671M0H4_BMF-02      ttcctcccgcgttcagataaagcagaccgagacagcagggacaccccctg
A0A671MNR9_BMF-01      ttcctcccgcgttcagataaagcagaccgagacagcagggagaccccctc
                       ***************************************** ******* 

A0A671M0H4_BMF-01      tatcccccagcggcatgctgccctgccgagtgcatgtcgagcccacacgc
A0A671M0H4_BMF-02      tatcccccagcggcatgctgccctgccgagtgcatgtcgagcccacacgc
A0A671MNR9_BMF-01      tatcccccagcggcatgctgccctgccgagtgaatgtggagcccagacgc
                       ******************************** **** ******* ****

A0A671M0H4_BMF-01      tttctctacgggaacgcaggattgttacttctagcgtctcccagccgctc
A0A671M0H4_BMF-02      tttctctacgggaacgcaggattgttacttctagcgtctcccagccgctc
A0A671MNR9_BMF-01      tttctctacggtaacacaggactgctgctgctagcgccgcctagccgctc
                       *********** *** ***** ** * ** ****** * ** ********

A0A671M0H4_BMF-01      tcagcctccagacgtggttctccggcaggacctgcggatgatggacccag
A0A671M0H4_BMF-02      tcagcctccagacgtggttctccggcaggacctgcggatgatggacccag
A0A671MNR9_BMF-01      tcggcctccagacgtggttctccggcagaacctgcgcatgatggatccgg
                       ** ************************* ******* ******** ** *

A0A671M0H4_BMF-01      cggtggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctc
A0A671M0H4_BMF-02      cggtggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctc
A0A671MNR9_BMF-01      cgg---------------agagcgtggagaccctcatcgggcagaagctc
                       ***                *******************************

A0A671M0H4_BMF-01      cagctgatcggagatcagttctatcaggagcacatgatg-----gtgagt
A0A671M0H4_BMF-02      cagctgatcggagatcagttctatcaggagcacatgatg-----gtgagt
A0A671MNR9_BMF-01      cagctgatcggagatcagttctatcaggagcacatgatgcatcacagaaa
                       ***************************************       **  

A0A671M0H4_BMF-01      cgggtcgggtcaggagatcctgtgaacgtgttttctgtgcgctgg-atca
A0A671M0H4_BMF-02      cgggtcgggtcaggagatcctgtgaacgtgttttctgtgcgctgg-atca
A0A671MNR9_BMF-01      ccaaaggaaccgggagccgctgtggtggcgcgt----ggcggtggcgttc
                       *     *   * ****   *****   * *  *     *** ***  *  

A0A671M0H4_BMF-01      taatcgcattatgtcttgctttagcgctcgtttacacaaaagcgttttcc
A0A671M0H4_BMF-02      taatcgcattatgtcttgctttagcgctcgtttacacaaaagcgttttcc
A0A671MNR9_BMF-01      ta--cacgcttttatttggaagagagccca---acgcaagagcaaatcgc
                       **  * *  * *   ***    ** ** *    ** *** ***   *  *

A0A671M0H4_BMF-01      atgtgccgtgtttgttttggacggactgtttcctga
A0A671M0H4_BMF-02      atgtgccgtgtttgttttggacggactgtttcctga
A0A671MNR9_BMF-01      agg------------------------------tga
                       * *                              ***

© 1998-2021Legal notice