Dataset for CDS BMF of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A671M0H4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BMF (length=480 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcgctggccttcctcccgcgttcagataaagcagaccga
gacagcagggacaccccctgtatcccccagcggcatgctgccctgccgagtgcatgtcgagcccacacgctttctctacg
ggaacgcaggattgttacttctagcgtctcccagccgctctcagcctccagacgtggttctccggcaggacctgcggatg
atggacccagcggtggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagtt
ctatcaggagcacatgatggtgagtcgggtcgggtcaggagatcctgtgaacgtgttttctgtgcgctggatcataatcg
cattatgtcttgctttagcgctcgtttacacaaaagcgttttccatgtgccgtgtttgttttggacggactgtttcctga
>gnl|bcl2dbcds|A0A671M0H4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BMF (length=480 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcgctggccttcctcccgcgttcagataaagcagaccga
gacagcagggacaccccctgtatcccccagcggcatgctgccctgccgagtgcatgtcgagcccacacgctttctctacg
ggaacgcaggattgttacttctagcgtctcccagccgctctcagcctccagacgtggttctccggcaggacctgcggatg
atggacccagcggtggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagtt
ctatcaggagcacatgatggtgagtcgggtcgggtcaggagatcctgtgaacgtgttttctgtgcgctggatcataatcg
cattatgtcttgctttagcgctcgtttacacaaaagcgttttccatgtgccgtgtttgttttggacggactgtttcctga
>gnl|bcl2dbcds|A0A671MNR9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BMF (length=432 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggccttcctcccgcgttcagataaagcagaccga
gacagcagggagaccccctctatcccccagcggcatgctgccctgccgagtgaatgtggagcccagacgctttctctacg
gtaacacaggactgctgctgctagcgccgcctagccgctctcggcctccagacgtggttctccggcagaacctgcgcatg
atggatccggcggagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacat
gatgcatcacagaaaccaaaggaaccgggagccgctgtggtggcgcgtggcggtggcgttctacacgcttttatttggaa
gagagcccaacgcaagagcaaatcgcaggtga
© 1998-2020Legal notice