Dataset for CDS classical BH3-containing proteins of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S3N9Q3_BAD-01       atg--------------------------------------------gct
A0A1S3SNN2_BMF-01       atg--------------------------------------------gat
A0A1S3P5K4_BMF-01       atg--------------------------------------------gac
A0A1S3P5K4_BMF-02       atg--------------------------------------------gac
A0A1S3SAH9_BCL2L11      atgtccgattcgtccagacaacaaaatcagtccaatggctcgaccatcct
B5X1T1_BAD-01           atg-------------gaccacaca----------------------cat
A0A1S3L0Z2_BAD-01       atg-------------gactacaca----------------------cat
B5XEF1_BAD-01           atg-------------gactacaca----------------------cat
                        ***                                               

A0A1S3N9Q3_BAD-01       ca----------ga--------------------tatttactatatcaga
A0A1S3SNN2_BMF-01       gatgaggaggatga--------------------tgtgt-ttgtgccaga
A0A1S3P5K4_BMF-01       gatgaggaggatga--------------------tgtgt-ttgaaccaga
A0A1S3P5K4_BMF-02       gatgaggaggatga--------------------tgtgt-ttgaaccaga
A0A1S3SAH9_BCL2L11      aattgagagaggga--------------------aatacggagaattgaa
B5X1T1_BAD-01           gattgtgtggatgacaacccagaaaccatgaatgaacatgatgagtctga
A0A1S3L0Z2_BAD-01       gattgtgtggatga-----------------------atg-tgagtctga
B5XEF1_BAD-01           gattgtgtggatga-----------------------atg-tgagtctga
                         *          **                                   *

A0A1S3N9Q3_BAD-01       ---------------------------cagtgagtcagag---gaggtag
A0A1S3SNN2_BMF-01       ctcctcccactgctggcgcacagccttcagggaaataaagtacgaggaca
A0A1S3P5K4_BMF-01       ---ctcccactgctggcgcacagccttcagggagataaagtacgaggaca
A0A1S3P5K4_BMF-02       ---ctcccactgctggcgcacagccttcagggagataaagtacgaggaca
A0A1S3SAH9_BCL2L11      ------tcccggtggcggagcagcctccggtgccgaaccgactga-----
B5X1T1_BAD-01           ------cc---------------actcaggaaccacac------a-----
A0A1S3L0Z2_BAD-01       ------tc---------------actcaggaaccacac------g-----
B5XEF1_BAD-01           ------tc---------------actcaggaaccacac------g-----
                                                     *      *             

A0A1S3N9Q3_BAD-01       gagaaaccgaa---------------------------------------
A0A1S3SNN2_BMF-01       gaggcacccagacac------------ccagc------------------
A0A1S3P5K4_BMF-01       ggggaacccagacac------------ccagc------------------
A0A1S3P5K4_BMF-02       ggggaacccagacac------------ccagc------------------
A0A1S3SAH9_BCL2L11      ---caacccccagttcagcgaaagggaccagcagtcacggggaggaataa
B5X1T1_BAD-01           ---ctacccagaatt------------tcagc------------------
A0A1S3L0Z2_BAD-01       ---caactcagaatt------------ccagc------------------
B5XEF1_BAD-01           ---caactcagaatt------------ccagc------------------
                             **                                           

A0A1S3N9Q3_BAD-01       ------------------------aatgaccaatcgtctgccggaaaggg
A0A1S3SNN2_BMF-01       -------------cctgccctggcactgcccaacgacatgctgccctgtg
A0A1S3P5K4_BMF-01       -------------cctgtcctgccactgcccaataatatgctgccctgcg
A0A1S3P5K4_BMF-02       -------------cctgtcctgccactgcccaataatatgctgccctgcg
A0A1S3SAH9_BCL2L11      tgatgccgaatagtctgcttggtttccagtcga--ggtcgccgttgttca
B5X1T1_BAD-01           -------------gccattatgtctccactagg--acgggca-----tca
A0A1S3L0Z2_BAD-01       -------------tcc---atgtctcaactaca--atgagca-----aca
B5XEF1_BAD-01           -------------tcc---atgtctcaactaca--atgagca-----aca
                                                               **         

A0A1S3N9Q3_BAD-01       gatgac-----tggcggtccaa----------------------taggcc
A0A1S3SNN2_BMF-01       g-----------ggtggcccaggag-----------------cccagacc
A0A1S3P5K4_BMF-01       g-----------ggtggcccaggag-----------------cccagacc
A0A1S3P5K4_BMF-02       g-----------ggtggcccaggag-----------------cccagacc
A0A1S3SAH9_BCL2L11      gaacactgtccaggtcatccagtggatatttttcgttcgacagcgattct
B5X1T1_BAD-01           gaccac-gaccaggtgggcgagt-------------------gcggctct
A0A1S3L0Z2_BAD-01       gaccaa-gaccaggtgagcgagt-------------------ccggctct
B5XEF1_BAD-01           gaccaa-gaccaggtgagcgagt-------------------ccggctct
                        *           **    * *                           * 

A0A1S3N9Q3_BAD-01       acgcc----ctcactgt-------gcctgagatgagactggcaggagagg
A0A1S3SNN2_BMF-01       actct----tctatggcaacgcaggctttcgattgcactttcc----agc
A0A1S3P5K4_BMF-01       actct----tctacggcaacgcaggctttcgattgcacttccc----agc
A0A1S3P5K4_BMF-02       actct----tctacggcaacgcaggctttcgattgcacttccc----agc
A0A1S3SAH9_BCL2L11      attccaagctccccggtattgaaagataacaagtcgacaca------gac
B5X1T1_BAD-01           actccgag-tcccaggtgt-----gctcccaggttggcagaagggacaac
A0A1S3L0Z2_BAD-01       actcagag-tcccaggtgt-----gctcccaggttggcaaaagggaagac
B5XEF1_BAD-01           actcagag-tcccaggtgc-----gctcccaggttggcaaaagggaagac
                        *  *           *        *            *            

A0A1S3N9Q3_BAD-01       gtcg------gttgaggatgaactcagagtcccaggccc-----aggagc
A0A1S3SNN2_BMF-01       gcgg------tttgagcagg---ttggagaccaggggcctcaggagcagc
A0A1S3P5K4_BMF-01       gcag------tttgagcgtg---ttggagaccaggggcc-----------
A0A1S3P5K4_BMF-02       gcag------tttgagcgtg---ttggagaccaggggcc-----------
A0A1S3SAH9_BCL2L11      tccgagcccatctagccaag---tcatgactcacgcact-----------
B5X1T1_BAD-01           acagag----tttcaggatg---tgatgactc-----ct-----------
A0A1S3L0Z2_BAD-01       acagag----tttcaggatg---tgatgactc-----ct-----------
B5XEF1_BAD-01           acagag----tttcaggatg---tgatgactc-----ct-----------
                           *        *      *   *       *     *            

A0A1S3N9Q3_BAD-01       tccagggtagg----gggccaggggtggaaggcatgcccacagatggagc
A0A1S3SNN2_BMF-01       atcagg---gg----gagcgaggga----------------ggatggaac
A0A1S3P5K4_BMF-01       -tctgg---ga----gagcgagggg----------------ggatggaga
A0A1S3P5K4_BMF-02       -tctgg---ga----gagcgagggg----------------ggatggaga
A0A1S3SAH9_BCL2L11      -gcagcgcatgtctcaagcacagg-----------------agaccaatc
B5X1T1_BAD-01           -actgaggagg------gcggtgg-----------------cgatggggc
A0A1S3L0Z2_BAD-01       -actgaggagg------gtggggg-----------------tgatggggc
B5XEF1_BAD-01           -actgaggagg------gtggggg-----------------tgatggggc
                          * *            *    **                  **      

A0A1S3N9Q3_BAD-01       atctttccggggtcgctcccagtcggccccccc--tgc--cctctgg---
A0A1S3SNN2_BMF-01       ggct------------------tcaa------c--agcagccagcgc---
A0A1S3P5K4_BMF-01       ggct---------------caatcagcagcccc--agcagccagcac---
A0A1S3P5K4_BMF-02       ggct---------------caatcagcagcccc--agcagccagcac---
A0A1S3SAH9_BCL2L11      gagattatgacgcgtggcccaaccccctccacccctatagaccacggcca
B5X1T1_BAD-01           tcctttccgaagccgatcacagtctgctcctcc----tacactgtgg---
A0A1S3L0Z2_BAD-01       ttcattccgaggtcgatcacagtctgctcctcc----tgcactatgg---
B5XEF1_BAD-01           ttcattccgaggtcgatcacagtctgctcctcc----tgcactatgg---
                                               *        *        *        

A0A1S3N9Q3_BAD-01       ------gcggccaagag-ata-----------------cgggcggcagct
A0A1S3SNN2_BMF-01       ------aaagcatggag-gtctgcat------------tggacagaaact
A0A1S3P5K4_BMF-01       ------gcagcatagag-atctgcat------------tggacagaaact
A0A1S3P5K4_BMF-02       ------gcagcatagag-atctgcat------------tggacagaaact
A0A1S3SAH9_BCL2L11      ccgccaactgcaggggacatgtggccagagacactgatcggtcaggagct
B5X1T1_BAD-01           ------gctgcaaagaa-atatggcc--------------gcc---agct
A0A1S3L0Z2_BAD-01       ------gctgcaaagaa-atatggct--------------gcc---agct
B5XEF1_BAD-01           ------gctgcaaagaa-atatggct--------------gcc---agct
                                 **   *    *                    * *   * **

A0A1S3N9Q3_BAD-01       ccgacgcatgagtgacgagtttgat-------------------------
A0A1S3SNN2_BMF-01       ccaactcatcggagaccagttctaccaagaacaccttcaact--------
A0A1S3P5K4_BMF-01       ccaactcatcggagaccagttccaccaagaacatgttcaagtggtgagaa
A0A1S3P5K4_BMF-02       ccaactcatcggagaccagttccaccaagaacatgttcaagt--------
A0A1S3SAH9_BCL2L11      tcagcgcattggagatgagtttaacg------------------------
B5X1T1_BAD-01           gaggaggatgagtgatgaatttgac-------------------------
A0A1S3L0Z2_BAD-01       gaggaggatgagtgatgaatttgac-------------------------
B5XEF1_BAD-01           gaggaggatgagtgatgaatttgac-------------------------
                               **  * **  * **  *                          

A0A1S3N9Q3_BAD-01       -----------------------acgtggctgga----------------
A0A1S3SNN2_BMF-01       -----------------------gtatcaccgaaacc-------------
A0A1S3P5K4_BMF-01       tacccaacgtgactgactgcacagcacagctaaagcccactgaacaggcc
A0A1S3P5K4_BMF-02       -----------------------gtatcaccgaaacc-------------
A0A1S3SAH9_BCL2L11      -----------------------atctcgtcatg----------------
B5X1T1_BAD-01           -----------------------acctggctcga----------------
A0A1S3L0Z2_BAD-01       -----------------------acctggctcga----------------
B5XEF1_BAD-01           -----------------------acctggctcga----------------
                                                                          

A0A1S3N9Q3_BAD-01       --------------------taaaggggagatgaggcgggtgaagag---
A0A1S3SNN2_BMF-01       ------------------------aaaggaac----------atgag---
A0A1S3P5K4_BMF-01       tactgtactcagaggtctgctgagagagagactgagcagcagaagtg---
A0A1S3P5K4_BMF-02       ------------------------aaagaaac----------atgag---
A0A1S3SAH9_BCL2L11      --------------------catcgccttgttgacggaaacggtcaggtt
B5X1T1_BAD-01           --------------------caaaggggaacccaagagagggataa----
A0A1S3L0Z2_BAD-01       --------------------caaaggggtgcccaagagagggatta----
B5XEF1_BAD-01           --------------------caaaggggtgcccaagagagggatta----
                                                                          

A0A1S3N9Q3_BAD-01       -----tgcgggagcagccaaacagatgaccaagtcccccagctggtgggc
A0A1S3SNN2_BMF-01       gcccatgtggtggcgcc--------tggcctcagct-----ctgttcacc
A0A1S3P5K4_BMF-01       gcttctttacgggcatcca---ttgtgttcacgtct-----cagtgtccc
A0A1S3P5K4_BMF-02       gcccttgtggaggcgcc--------tggcctcggct-----ctgctcacc
A0A1S3SAH9_BCL2L11      gcccaggaaaa--cctgcagcagatgcaccaagagc----------ccgc
B5X1T1_BAD-01           gcccaggaggggtcaagcaggaggtctcccgaggat----------ggtt
A0A1S3L0Z2_BAD-01       tcccaagaggaggcaagcagaaagtctcccgaggat----------ggtt
B5XEF1_BAD-01           tcccaagaggaggcaagcagaaagtctcccgaggat----------ggtt
                                     *               *                    

A0A1S3N9Q3_BAD-01       ctacctgttcagtcataagga-------gaca----gagacagaacata-
A0A1S3SNN2_BMF-01       ctg-ctgtttgagcaggaggccattgctggaa----gggggagagcaggg
A0A1S3P5K4_BMF-01       ttgtttgttttggctag------tcagtgagc----atgcattagcccag
A0A1S3P5K4_BMF-02       ctg-ctgtttgagcaggaggccatcgctggag----gggagagagcaggg
A0A1S3SAH9_BCL2L11      cttcctactgtggatggggctcctgattggacgactattacagatcatcc
B5X1T1_BAD-01           ctctttcctctgg-----------------------agtccaaaaaaggc
A0A1S3L0Z2_BAD-01       ctctttcctctgg-----------------------agtccaaaggaggc
B5XEF1_BAD-01           ctctttcctctgg-----------------------agtccaaaggaggc
                         *   *  *                                  *      

A0A1S3N9Q3_BAD-01       -----------cccctaccatcccaccacgatcatctgagtag
A0A1S3SNN2_BMF-01       tg---------------------------ga-------ggtga
A0A1S3P5K4_BMF-01       tgttctgacctctcattctacccccccaaga-------cgtag
A0A1S3P5K4_BMF-02       tg---------------------------ga-------ggtga
A0A1S3SAH9_BCL2L11      tg---------------------------cag--agaagatga
B5X1T1_BAD-01           tg---------------------------aaggcagggagtga
A0A1S3L0Z2_BAD-01       gg---------------------------aaggcagggagtga
B5XEF1_BAD-01           gg---------------------------aaggcagggagtga
                                                      *         *  

© 1998-2022Legal notice