Dataset for CDS classical BH3-containing proteins of organism Salmo salar

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A1S3L0Z2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=444 residues).
atggactacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacgcaactcagaattccagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggtcgatcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A1S3N9Q3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=477 residues).
atggctcagatatttactatatcagacagtgagtcagaggaggtaggagaaaccgaaaatgaccaatcgtctgccggaaa
ggggatgactggcggtccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggttgaggatga
actcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagatggagcatctttccgg
ggtcgctcccagtcggccccccctgccctctgggcggccaagagatacgggcggcagctccgacgcatgagtgacgagtt
tgatacgtggctggataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagtcccccagct
ggtgggcctacctgttcagtcataaggagacagagacagaacatacccctaccatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A1S3P5K4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=585 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacatgttcaagtggtgagaatacccaacgtgactgactgcacagcacagc
taaagcccactgaacaggcctactgtactcagaggtctgctgagagagagactgagcagcagaagtggcttctttacggg
catccattgtgttcacgtctcagtgtcccttgtttgttttggctagtcagtgagcatgcattagcccagtgttctgacct
ctcattctacccccccaagacgtag
>gnl|bcl2dbcds|A0A1S3P5K4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacatgttcaagtgtatcaccgaaaccaaagaaacatgaggcccttgtgga
ggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggagagagcagggtggaggtga
>gnl|bcl2dbcds|A0A1S3SAH9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Salmo salar GN=BCL2L11 (length=645 residues).
atgtccgattcgtccagacaacaaaatcagtccaatggctcgaccatcctaattgagagagggaaatacggagaattgaa
tcccggtggcggagcagcctccggtgccgaaccgactgacaacccccagttcagcgaaagggaccagcagtcacggggag
gaataatgatgccgaatagtctgcttggtttccagtcgaggtcgccgttgttcagaacactgtccaggtcatccagtgga
tatttttcgttcgacagcgattctattccaagctccccggtattgaaagataacaagtcgacacagactccgagcccatc
tagccaagtcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaatcgagattatgacgcgtggcccaacc
ccctccacccctatagaccacggccaccgccaactgcaggggacatgtggccagagacactgatcggtcaggagcttcag
cgcattggagatgagtttaacgatctcgtcatgcatcgccttgttgacggaaacggtcaggttgcccaggaaaacctgca
gcagatgcaccaagagcccgccttcctactgtggatggggctcctgattggacgactattacagatcatcctgcagagaa
gatga
>gnl|bcl2dbcds|A0A1S3SNN2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctatggcaacgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcag
gagcagcatcagggggagcgagggaggatggaacggcttcaacagcagccagcgcaaagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccca
tgtggtggcgcctggcctcagctctgttcaccctgctgtttgagcaggaggccattgctggaagggggagagcagggtgg
aggtga
>gnl|bcl2dbcds|B5X1T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacatgatgagtctgaccactcaggaaccac
acactacccagaatttcagcgccattatgtctccactaggacgggcatcagaccacgaccaggtgggcgagtgcggctct
actccgagtcccaggtgtgctcccaggttggcagaagggacaacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctcctacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|B5XEF1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=444 residues).
atggactacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacgcaactcagaattccagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgcgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggtcgatcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
© 1998-2022Legal notice