Dataset for CDS BAD of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S3N9Q3_BAD-01      atggctcagatatttactatatcagacagtgagtcagaggaggtaggaga
B5X1T1_BAD-01          atggaccacacacat---------gattgtgtg---gatgacaacccaga
A0A1S3L0Z2_BAD-01      atggactacacacat---------gattgtgtg---gatga---------
B5XEF1_BAD-01          atggactacacacat---------gattgtgtg---gatga---------
                       ****   * * *  *         **  *** *   ** **         

A0A1S3N9Q3_BAD-01      aaccgaaaatgacca---atcgtctgccggaaaggggatgactggcggtc
B5X1T1_BAD-01          aaccatgaatgaacatgatgagtctgaccactcaggaaccacacactacc
A0A1S3L0Z2_BAD-01      --------------atg-tgagtctgatcactcaggaaccacacgcaact
B5XEF1_BAD-01          --------------atg-tgagtctgatcactcaggaaccacacgcaact
                                     *      *****        ** *  **   *    

A0A1S3N9Q3_BAD-01      caataggcc---------acgccctcactgtgcctgagatgagactggca
B5X1T1_BAD-01          cagaatttcagcgccattatgtctccactaggacgggcatcagaccacga
A0A1S3L0Z2_BAD-01      cagaattccagctcc---atgtctcaactacaatgagcaacagaccaaga
B5XEF1_BAD-01          cagaattccagctcc---atgtctcaactacaatgagcaacagaccaaga
                       **  *   *         * * *   ***         *  ****    *

A0A1S3N9Q3_BAD-01      ggagagggtcggttgaggatgaactcagagtcccagg------cccag--
B5X1T1_BAD-01          ccaggtgggcgagtgcggctctactccgagtcccaggtgtgctcccaggt
A0A1S3L0Z2_BAD-01      ccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccaggt
B5XEF1_BAD-01          ccaggtgagcgagtccggctctactcagagtcccaggtgcgctcccaggt
                         **  *  **  *  ** *  **** **********      *****  

A0A1S3N9Q3_BAD-01      -------------------gagctccagggt----------------agg
B5X1T1_BAD-01          tggcagaagggacaacacagagtttcaggatgtgatgactcctactgagg
A0A1S3L0Z2_BAD-01      tggcaaaagggaagacacagagtttcaggatgtgatgactcctactgagg
B5XEF1_BAD-01          tggcaaaagggaagacacagagtttcaggatgtgatgactcctactgagg
                                          *** * **** *                ***

A0A1S3N9Q3_BAD-01      gggccaggggtggaaggcatgcccacagatggagcatctttccggggtcg
B5X1T1_BAD-01          agggcggtggc----------------gatggggctcctttccgaagccg
A0A1S3L0Z2_BAD-01      agggtgggggt----------------gatggggcttcattccgaggtcg
B5XEF1_BAD-01          agggtgggggt----------------gatggggcttcattccgaggtcg
                        **   * **                 ***** **  * *****  * **

A0A1S3N9Q3_BAD-01      ctcccagtcggccccccctgccctctgggcggccaagagatacgggcggc
B5X1T1_BAD-01          atcacagtctgctcctcctacactgtgggctgcaaagaaatatggccgcc
A0A1S3L0Z2_BAD-01      atcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgcc
B5XEF1_BAD-01          atcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgcc
                        ** ***** ** ** *** * ** ***** ** **** *** **  * *

A0A1S3N9Q3_BAD-01      agctccgacgcatgagtgacgagtttgatacgtggctggataaaggggag
B5X1T1_BAD-01          agctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaa
A0A1S3L0Z2_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggtg
B5XEF1_BAD-01          agctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggtg
                       ****  *  * ******** ** ***** ** ***** ** *******  

A0A1S3N9Q3_BAD-01      atgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagtcccc
B5X1T1_BAD-01          cccaagagagggataagcccaggaggggtcaagcagg-----aggtctcc
A0A1S3L0Z2_BAD-01      cccaagagagggattatcccaagaggaggcaagcaga-----aagtctcc
B5XEF1_BAD-01          cccaagagagggattatcccaagaggaggcaagcaga-----aagtctcc
                          * * * * **  *   *  ***  * *** ***      * *** **

A0A1S3N9Q3_BAD-01      c--agctggtgggcctacctgttcagtcataaggagacag-agacagaac
B5X1T1_BAD-01          cgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagg--
A0A1S3L0Z2_BAD-01      cgaggatggttctctttcctctggagtccaaaggaggcggaaggcagg--
B5XEF1_BAD-01          cgaggatggttctctttcctctggagtccaaaggaggcggaaggcagg--
                       *   * ****   * * *** *  ****  **  ** * * ** ***   

A0A1S3N9Q3_BAD-01      atacccctaccatcccaccacgatcatctgagtag
B5X1T1_BAD-01          -----------------------------gagtga
A0A1S3L0Z2_BAD-01      -----------------------------gagtga
B5XEF1_BAD-01          -----------------------------gagtga
                                                    ****  

© 1998-2022Legal notice