Dataset for CDS BCL2L11 of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
                        **************************************************

A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
                        **************************************************

A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaa---------------------------
A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8C8ZU60_BCL2L11      cctccctacagacagagcccca----------------------------
                        **********************                            

A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8C8ZU60_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8C8ZU60_BCL2L11      --------------------------------------------------
                                                                          

A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8C8ZU60_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8C8ZU60_BCL2L11      --------------------------------------------------
                                                                          

A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      gaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C8ZU60_BCL2L11      gaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C8ZU60_BCL2L11      --------------------------------------------------
                                                                          

A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C8ZU60_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C8ZU60_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A8C8ZU60_BCL2L11      -------------------------------------------gcttcca
A0A8C8ZU60_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A8C8ZU60_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A8C8ZU60_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
                                                                   *******

A0A8C8ZU60_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8C8ZU60_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8C8ZU60_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8C8ZU60_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
                        **************************************************

A0A8C8ZU60_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A8C8ZU60_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A8C8ZU60_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A8C8ZU60_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
                        **************************************************

A0A8C8ZU60_BCL2L11      gaggct--------------ggcaaaacccctggtacccccc--atatga
A0A8C8ZU60_BCL2L11      gaggtt------------------agag----------------aaatag
A0A8C8ZU60_BCL2L11      gagggtatttttgaataattaccaagaggctgaagacctccctcaaatgg
A0A8C8ZU60_BCL2L11      gagggtatttttgaataattaccaagaggctgaagacctccctcaaatgg
                        **** *                  * *                 * **  

A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      ttatcttacgactgttacgttaccttgtccgcctggtgtgggggaggcat
A0A8C8ZU60_BCL2L11      ttatcttacgactgttacgttaccttgtccgcctggtgtgggggaggcat
                                                                          

A0A8C8ZU60_BCL2L11      ---
A0A8C8ZU60_BCL2L11      ---
A0A8C8ZU60_BCL2L11      tga
A0A8C8ZU60_BCL2L11      tga
                           

© 1998-2022Legal notice