Dataset for CDS BCL2L11 of organism Prolemur simus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggagggtatttttgaataattaccaagaggctgaagacctccctcaaatggttatcttacg
actgttacgttaccttgtccgcctggtgtgggggaggcattga
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcaatttcaggctgaa
cctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
gagggtatttttgaataattaccaagaggctgaagacctccctcaaatggttatcttacgactgttacgttaccttgtcc
gcctggtgtgggggaggcattga
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaagcttccatgaggcaatttcaggctgaacctgcagata
tgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaaggaggctggca
aaacccctggtaccccccatatga
© 1998-2022Legal notice