Dataset for CDS classical BH3-containing proteins of organism Physeter macrocephalus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2Y9TJ73_PMAIP1-      atg---------cc--------------t---------------------
A0A2Y9T3Y6_BCL2L11      atggcaaagcaacc--------------ttccgatgtaagttctgagtgt
A0A2Y9T3Y6_BCL2L11      atggcaaagcaacc--------------ttccgatgtaagttctgagtgt
A0A2Y9T3Y6_BCL2L11      atggcaaagcaacc--------------ttccgatgtaagttctgagtgt
A0A2Y9EHU3_BAD-01       atgttccagatcccagagtttgagcagagtgagcaggaagactccagccc
A0A2Y9SD47_HRK-01       atgtgcccgtgccc-----------------------------cctgcac
                        ***         **                                    

A0A2Y9TJ73_PMAIP1-      -----ggaagg-----------agggc------------tcgtaagagc-
A0A2Y9T3Y6_BCL2L11      gacagagaagg-----------tggacaattgcagactgccgaaaggcct
A0A2Y9T3Y6_BCL2L11      gacagagaagg-----------tggacaattgcagactgccgaaaggcct
A0A2Y9T3Y6_BCL2L11      gacagagaagg-----------tggacaattgcagactgccgaaaggcct
A0A2Y9EHU3_BAD-01       tgcagataggggcc--------tgggccccagccccacaggggacaagcc
A0A2Y9SD47_HRK-01       cgcggccgcggcccgccggcggtgtgcgcctgcagcgcggg------ccg
                                 **            *  *                     * 

A0A2Y9TJ73_PMAIP1-      -----gctca----------------------------------------
A0A2Y9T3Y6_BCL2L11      cctcagctcaggcctgg-------------------------ggccccca
A0A2Y9T3Y6_BCL2L11      cctcagctcaggcctgg-------------------------ggccccca
A0A2Y9T3Y6_BCL2L11      cctcagctcaggcctgg-------------------------ggccccca
A0A2Y9EHU3_BAD-01       cccaggtcccagcaagcaccggcaaacggccccaggcctcctgggggaag
A0A2Y9SD47_HRK-01       cctgggtctgcgctcgt-ccgccgcgcagctcacggccgcccggctcaag
                             *                                            

A0A2Y9TJ73_PMAIP1-      -------------------gca----------------------------
A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggca----------------------------
A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A2Y9EHU3_BAD-01       ctggtcaccagcaggggcagccagccagcagcagc-caccatggaggcac
A0A2Y9SD47_HRK-01       gcgctc---------ggcgacgagct-gcaccagcgcaccatg-------
                                            *                             

A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      tgcccccaaggcagcccgcagggcccactggccccaccggccagtcccgg
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      tgcccccaaggcagcccgcagggcccactggccccaccggccagtcccgg
A0A2Y9EHU3_BAD-01       tggtgctgtggacacccggagtcgccacagctcctactccgcggggacgg
A0A2Y9SD47_HRK-01       ----------------tggcggcgccgcg----------cgcggagccgg
                                                                          

A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      cccttttgctaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      cccttttgctaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A2Y9EHU3_BAD-01       --------------------------------------------------
A0A2Y9SD47_HRK-01       --------------------------------------------------
                                                                          

A0A2Y9TJ73_PMAIP1-      ----------------------------------------------gagc
A0A2Y9T3Y6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2Y9T3Y6_BCL2L11      ----------------------------------------agacaggagc
A0A2Y9T3Y6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2Y9EHU3_BAD-01       --------------------aggatgacgaagggacggaggaggaggagc
A0A2Y9SD47_HRK-01       --------------------agggcgcc-----------------ggcgc
                                                                      * **

A0A2Y9TJ73_PMAIP1-      ccgac---------------------------------------------
A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A2Y9EHU3_BAD-01       ccagcccctttcggggccgctcgcgctcggcacccccca---acctctgg
A0A2Y9SD47_HRK-01       ccagc------------------------gcgctcccca---cctactgg
                        **  *                                             

A0A2Y9TJ73_PMAIP1-      ------------------------------------------gcgggccc
A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A2Y9EHU3_BAD-01       gctgcacagcgatatggccgcgagctccggaggatgagcgacgagttcca
A0A2Y9SD47_HRK-01       ccc-----------tggctgtg--------------------------cg
                                                                          

A0A2Y9TJ73_PMAIP1-      cggcagatcctgaag-----------------ttgagtgtgccattcagt
A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaag--agt
A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaag--agt
A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaag--agt
A0A2Y9EHU3_BAD-01       cggctccttcaaaggacttcctcgcc------cgaagagcgcggg--cac
A0A2Y9SD47_HRK-01       cggcc---------------------------------gcgcagg----t
                         ***                                  * **        

A0A2Y9TJ73_PMAIP1-      tcaggagaattggagacaa-------actga-------------atttcc
A0A2Y9T3Y6_BCL2L11      tgcggcgtattggagacga-------atttaatg-------catattacc
A0A2Y9T3Y6_BCL2L11      tgcggcgtattggagacga-------atttaatg-------catattacc
A0A2Y9T3Y6_BCL2L11      tgcggcgtattggagacga-------atttaatg-------catattacc
A0A2Y9EHU3_BAD-01       agcgacgcagatgcgacaaagccccagctggacgcgcttccttcagtcct
A0A2Y9SD47_HRK-01       ggcggcgc-----tggcag---cctggctgctcg----------------
                           *  *       * *           *                     

A0A2Y9TJ73_PMAIP1-      ggcagaaact---tctgaat------------------------------
A0A2Y9T3Y6_BCL2L11      caaggaggtt----------------------------------------
A0A2Y9T3Y6_BCL2L11      caaggagggtctttctgaataatcaccaagcagccgaaggtcacccgcaa
A0A2Y9T3Y6_BCL2L11      caaggagggtctttctgaataatcaccaagcagccgaaggtcacccgcaa
A0A2Y9EHU3_BAD-01       ggtggaaccggaacttg---------------------------------
A0A2Y9SD47_HRK-01       ---gcaggcggaacttg---------------------------------
                             *                                            

A0A2Y9TJ73_PMAIP1-      ---------------ttgatatccaaactcttccgctc-------aggaa
A0A2Y9T3Y6_BCL2L11      -----------------------------------------------aga
A0A2Y9T3Y6_BCL2L11      atggttatcttacgactgttacgccacatcatccgtctggtgtggaggat
A0A2Y9T3Y6_BCL2L11      atggttatcttacgactgttacgccacatcatccgtctggtgtggaggat
A0A2Y9EHU3_BAD-01       ---------------gggagaggaggccccgccccctc------------
A0A2Y9SD47_HRK-01       ---------------tag--------------------------------
                                                                          

A0A2Y9TJ73_PMAIP1-      cc--tga
A0A2Y9T3Y6_BCL2L11      gcaatag
A0A2Y9T3Y6_BCL2L11      gcagtga
A0A2Y9T3Y6_BCL2L11      gcagtga
A0A2Y9EHU3_BAD-01       ccagtga
A0A2Y9SD47_HRK-01       -------
                               

© 1998-2020Legal notice