Dataset for CDS classical BH3-containing proteins of organism Physeter macrocephalus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A2Y9EHU3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Physeter macrocephalus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaagcccccaggtcccagcaagcaccggcaaacggccccaggcctcctgggggaagctggtcaccagcaggggc
agccagccagcagcagccaccatggaggcactggtgctgtggacacccggagtcgccacagctcctactccgcggggacg
gaggatgacgaagggacggaggaggaggagcccagcccctttcggggccgctcgcgctcggcaccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagttccacggctccttcaaaggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcttccttcagtcctggtggaaccggaacttgggg
agaggaggccccgccccctcccagtga
>gnl|bcl2dbcds|A0A2Y9SD47_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Physeter macrocephalus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggcccgccggcggtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcagcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2Y9T3Y6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Physeter macrocephalus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagactgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgta
cctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gagggtctttctgaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgactgttacgccacatcatcc
gtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A2Y9T3Y6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Physeter macrocephalus GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagactgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccactggccccaccggccagtcccggcccttttgctaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgactgttacgcca
catcatccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A2Y9T3Y6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Physeter macrocephalus GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagactgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccactggccccaccggccagtcccggcccttttgctaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A2Y9TJ73_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Physeter macrocephalus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgctcagcagagcccgacgcgggccccggcagatcctgaagttgagtgtgccat
tcagttcaggagaattggagacaaactgaatttccggcagaaacttctgaatttgatatccaaactcttccgctcaggaa
cctga
© 1998-2020Legal notice