Dataset for CDS BMF of organism Phasianus colchicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A669PL85_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A669PL85_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A669PL85_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A669PL85_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A669PL85_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A669PL85_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                       **************************************************

A0A669PL85_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A669PL85_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
                       **************************************************

A0A669PL85_BMF-01      tgtcaggcaaccagagcagcaggacaaggcaactcaaacactcagcccgt
A0A669PL85_BMF-02      tgtcaggcaaccagagcagcaggacaaggcaactcaaacactcagcccgt
                       **************************************************

A0A669PL85_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A669PL85_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A669PL85_BMF-01      cggagactcttctatgggaatgctggttaccgcttacatgtccccccagt
A0A669PL85_BMF-02      cggagactcttctatgggaatgctggttaccgcttacatgtccccccagt
                       **************************************************

A0A669PL85_BMF-01      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A0A669PL85_BMF-02      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
                       **************************************************

A0A669PL85_BMF-01      gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgca
A0A669PL85_BMF-02      gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgca
                       **************************************************

A0A669PL85_BMF-01      gaccagttccaccggctccacatacagcgg-----------catcagcag
A0A669PL85_BMF-02      gaccagttccaccggctccacatacagcgggtagggtgtttcctcagggg
                       ******************************           * ****  *

A0A669PL85_BMF-01      aacagaaatcaagtgtggtggcagctttttctctttctacacaacttggc
A0A669PL85_BMF-02      aa--------------ggtgg--ggtatttcttatccaagagtggtgctc
                       **              *****  * * *****  * * * *    *   *

A0A669PL85_BMF-01      cttaaatgtggaggcgaac--------aggaaccgcactgggcagaggtg
A0A669PL85_BMF-02      cagaagactggctccaggcttcagctaagcaatggcctagggcagccata
                       *  **   ***   *   *        ** **  **   ******   * 

A0A669PL85_BMF-01      a
A0A669PL85_BMF-02      g
                        

© 1998-2020Legal notice