Dataset for CDS BMF of organism Phasianus colchicus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A669PL85_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Phasianus colchicus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcaaccagagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A669PL85_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Phasianus colchicus GN=BMF (length=585 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcaaccagagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttcctcaggggaaggtggggtatttcttatccaagagtggtgctccagaagactggctccaggcttcagct
aagcaatggcctagggcagccatag
© 1998-2020Legal notice