Dataset for CDS classical BH3-containing proteins of organism Peromyscus maniculatus bairdii

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I9LW27_BCL2L11      atggcc------------------aagcaaccttctgatgt-------aa
A0A6I9LW27_BCL2L11      atggcc------------------aagcaaccttctgatgt-------aa
A0A6I9LW27_BCL2L11      atggcc------------------aagcaaccttctgatgt-------aa
A0A6J0DIY6_PMAIP1-      atg-----------------------------ccccggagc---caggcg
A0A8C8TKK3_BBC3-01      atggcccgcgcacgccag----gagggcagctctccggagcccgtagaag
A0A6I9LQL5_BAD-01       atg-------------------gga------accccaaagc-------ag
A0A6I9LQL5_BAD-02       atg-------------------gga------accccaaagc-------ag
A0A6I9LHF8_BMF-01       atgcccggagcgggcgtattttggaaacaataccgcgcggtgcgccgtgg
A0A6I9LKH4_BIK-01       atgtc-----------------ggaggcaagact-catggc---cagaga
A0A8C8U1G0_BIK-01       atgtc-----------------ggaggcaagact-catggc---cagaga
                        ***                                    *          

A0A6I9LW27_BCL2L11      gttctgagtgtgacagagaaggtg--------------------------
A0A6I9LW27_BCL2L11      gttctgagtgtgacagagaaggtg--------------------------
A0A6I9LW27_BCL2L11      gttctgagtgtgacagagaaggtg--------------------------
A0A6J0DIY6_PMAIP1-      cgtccgaacgcgccatcgaacgca--------------------------
A0A8C8TKK3_BBC3-01      gcttggcccgcgacggcccgcgcc--------------------------
A0A6I9LQL5_BAD-01       cccttgctggctcctgcacatgccctaggc--------------------
A0A6I9LQL5_BAD-02       cccttgctggctcctgcacatgccctaggc--------------------
A0A6I9LHF8_BMF-01       cctcctctcgcgccagctcgcgcctgcagcagccgctgccctagctcgta
A0A6I9LKH4_BIK-01       cctcatcaag----------------------------------------
A0A8C8U1G0_BIK-01       cctcatcaag----------------------------------------
                                 *                                        

A0A6I9LW27_BCL2L11      -------------------------------------------gacaatt
A0A6I9LW27_BCL2L11      -------------------------------------------gacaatt
A0A6I9LW27_BCL2L11      -------------------------------------------gacaatt
A0A6J0DIY6_PMAIP1-      --------------------------------------------------
A0A8C8TKK3_BBC3-01      ---------------------------------------------ccttc
A0A6I9LQL5_BAD-01       --------------------------------------------------
A0A6I9LQL5_BAD-02       --------------------------------------------------
A0A6I9LHF8_BMF-01       ccaccgcctcccgccgcagcccgctggagtttgccccctccttccctatc
A0A6I9LKH4_BIK-01       --------------------------------------------actgtc
A0A8C8U1G0_BIK-01       --------------------------------------------actgtc
                                                                          

A0A6I9LW27_BCL2L11      gcagcctgctgagaggcctccccagc-----------ttaggcctggggc
A0A6I9LW27_BCL2L11      gcagcctgctgagaggcctccccagc-----------ttaggcctggggc
A0A6I9LW27_BCL2L11      gcagcctgctgagaggcctccccagc-----------ttaggcctggggc
A0A6J0DIY6_PMAIP1-      --gcgtgggca-----------gagc-----------tagcgcccgagtt
A0A8C8TKK3_BBC3-01      ccgctcggccgcctggtgccctccgc-----------tgtgtcctgcggc
A0A6I9LQL5_BAD-01       --gtgaggaagtcggatcccggaatc-----------cggagcctgggga
A0A6I9LQL5_BAD-02       --gtgaggaagtcggatcccggaatc-----------cggagcctgggga
A0A6I9LHF8_BMF-01       gagtgtgggcgccaagccccccgagtgctcgtcaccctggaccctggcgc
A0A6I9LKH4_BIK-01       ttgcatg---accaggtcccccgacctccag------tggctcctggggc
A0A8C8U1G0_BIK-01       ttgcatg---accaggtcccccgacctccag------tggctcctggggc
                                                                  ** *    

A0A6I9LW27_BCL2L11      ccctacc-------------------------------------------
A0A6I9LW27_BCL2L11      ccctacc-------------------------------------------
A0A6I9LW27_BCL2L11      ccctacc-------------------------------------------
A0A6J0DIY6_PMAIP1-      cgcagctca-----------------------------------------
A0A8C8TKK3_BBC3-01      -----ctctgcgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A6I9LQL5_BAD-01       ----gcgacgcaggaggaag------gcggtggagaccagca--------
A0A6I9LQL5_BAD-02       ----gcgacgcaggaggaag------gcggtggagaccagca--------
A0A6I9LHF8_BMF-01       agagccctggcatcacga----ctcggaggcagagactct----------
A0A6I9LKH4_BIK-01       ----tcccagcatgaaggagcccgtggaggaagaaaatatta--------
A0A8C8U1G0_BIK-01       ----tcccagcatgaaggag------------------------------
                             *                                            

A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6J0DIY6_PMAIP1-      --------------------------------------------------
A0A8C8TKK3_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A6I9LQL5_BAD-01       --------------------------------------------------
A0A6I9LQL5_BAD-02       --------------------------------------------------
A0A6I9LHF8_BMF-01       --------------------------------------------------
A0A6I9LKH4_BIK-01       --------------------------------------------------
A0A8C8U1G0_BIK-01       --------------------------------------------------
                                                                          

A0A6I9LW27_BCL2L11      -tccctacagacagaaccgca-----------------------------
A0A6I9LW27_BCL2L11      -tccctacagacagaaccgcaaggtaatcccgacggaggcggcgaagggg
A0A6I9LW27_BCL2L11      -tccctacagacagaaccgca-----------------------------
A0A6J0DIY6_PMAIP1-      -gctcaggaggatcggagacaaactgtattctgcgcggtgt---------
A0A8C8TKK3_BBC3-01      cgccctgg-----------------ggggcccccgctg-gcctgggggt-
A0A6I9LQL5_BAD-01       -gcccagagtatgttccagat-cccagagtttgagccgagtgagcagga-
A0A6I9LQL5_BAD-02       -gcccagagtatgttccagat-cccagagtttgagccgagtgagcagga-
A0A6I9LHF8_BMF-01       -gtcctggagtcacccaggagagatggagccaccgcagtgtgtggaggag
A0A6I9LKH4_BIK-01       -gtcctg--------tgagagacctggaccttgcggagtgcctggagga-
A0A8C8U1G0_BIK-01       ---cctg--------tgagagacctggaccttgcggagtgcctggagga-
                            *                                             

A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      accgctgcccccacggcagccctcagggcccgctggccccaccggccagc
A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6J0DIY6_PMAIP1-      --------------------------------------------------
A0A8C8TKK3_BBC3-01      ------------------------------------------------cc
A0A6I9LQL5_BAD-01       -------------------------agactccagtactgctgataggggc
A0A6I9LQL5_BAD-02       -------------------------agactccagtactgctgataggggc
A0A6I9LHF8_BMF-01       ctggaagatgatgtgttccagccagaggatggggagccagggacacaacc
A0A6I9LKH4_BIK-01       ----------------------caga--------aaccagg----tggcc
A0A8C8U1G0_BIK-01       ----------------------caga--------aaccagg----tggcc
                                                                          

A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      cctgggccttttgctaccagatccccacttttcatctttgtgagaagatc
A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6J0DIY6_PMAIP1-      ---gaacccgacatcactg--------------------------cggtg
A0A8C8TKK3_BBC3-01      ccgcagccggccc--------------------------cgaggcccgcg
A0A6I9LQL5_BAD-01       ctgggcccaagcttcactggggaccaacggggtccctacctggccccagg
A0A6I9LQL5_BAD-02       ctgggcccaagcttcactggggaccaacggggtccctacctggccccagg
A0A6I9LHF8_BMF-01       tgggagcttgct--ctctgctgacctg------------ttcgcccagag
A0A6I9LKH4_BIK-01       ctgaggctggcctacatcggtgatgag------------atggacctgtg
A0A8C8U1G0_BIK-01       ctgaggctggcctacatcggtgatgag------------atggacctgtg
                                                                          

A0A6I9LW27_BCL2L11      ---------------------------------------------agaca
A0A6I9LW27_BCL2L11      ttctctgctgtcccggtcctccagtgggtatttctcttttgacacagaca
A0A6I9LW27_BCL2L11      ---------------------------------------------agaca
A0A6J0DIY6_PMAIP1-      c--------------------------------------------tggcg
A0A8C8TKK3_BBC3-01      c--------------------------------------------c--cg
A0A6I9LQL5_BAD-01       t--------------------------------------------ctcct
A0A6I9LQL5_BAD-02       t--------------------------------------------ctcct
A0A6I9LHF8_BMF-01       c--------------------------------------------cagct
A0A6I9LKH4_BIK-01       t--------------------------------------------ctgcg
A0A8C8U1G0_BIK-01       t--------------------------------------------ctgcg
                                                                        * 

A0A6I9LW27_BCL2L11      ggagtccggcacccatgagttgtgacaagtcaacacaaa-----------
A0A6I9LW27_BCL2L11      ggagtccggcacccatgagttgtgacaagtcaacacaaa-----------
A0A6I9LW27_BCL2L11      ggagtccggcacccatgagttgtgacaagtcaacacaaa-----------
A0A6J0DIY6_PMAIP1-      gagatgcctgg---------------------------------------
A0A8C8TKK3_BBC3-01      gacggtcctcagccctcgctgtcaccggcccagcagcacctagagtcgcc
A0A6I9LQL5_BAD-01       ggggaacatcggacaccaacaggggcaggcagccaacagcagtcatcatg
A0A6I9LQL5_BAD-02       ggggaacatcggacaccaacaggggcaggcagccaacagcagtcatcatg
A0A6I9LHF8_BMF-01       ggattgcccc---ctcagccggctccagctcttccctctcactcattgct
A0A6I9LKH4_BIK-01       ga---gcccc---c---gtctggcccagct--------------------
A0A8C8U1G0_BIK-01       ga---gcccc---c---gtctggcccagct--------------------
                        *     *                                           

A0A6I9LW27_BCL2L11      ------------------------------------------ccccaagt
A0A6I9LW27_BCL2L11      ------------------------------------------ccccaagt
A0A6I9LW27_BCL2L11      ------------------------------------------ccccaagt
A0A6J0DIY6_PMAIP1-      ------------------------------------------caggaagg
A0A8C8TKK3_BBC3-01      cgtgcccagcgc------------------------------cccggagg
A0A6I9LQL5_BAD-01       gaggcgttggg-------------gctatggaga--------cccggagt
A0A6I9LQL5_BAD-02       gaggcgttggg-------------gctatggaga--------cccggagt
A0A6I9LHF8_BMF-01       gtggtcctgggctccggcccataagccaggaagacaaggccacccagacc
A0A6I9LKH4_BIK-01       ---gcccgggatt-----------gccatg------------cacagact
A0A8C8U1G0_BIK-01       ---gcccgggatt-----------gccatg------------cacagact
                                                                  *    *  

A0A6I9LW27_BCL2L11      cctccttgccaggccttc-----aacca---------------ttatctc
A0A6I9LW27_BCL2L11      cctccttgccaggccttc-----aacca---------------ttatctc
A0A6I9LW27_BCL2L11      cctccttgccaggccttc-----aacca---------------ttatctc
A0A6J0DIY6_PMAIP1-      cgcgaaagagcgc----------gaccaggagctc---------------
A0A8C8TKK3_BBC3-01      ccctggcgggcggcccc------acccaagcagccccgggagtgcgtggg
A0A6I9LQL5_BAD-01       cgccacagttcgtaccccgcggggaccgaggag-----------gatgaa
A0A6I9LQL5_BAD-02       cgccacagttcgtaccccgcggggaccgaggag-----------gatgaa
A0A6I9LHF8_BMF-01       ctcagcccagcttcccca-----agccagggtgttatgctgccttgtggg
A0A6I9LKH4_BIK-01       cgctgtca-----cctac-----agcca----------------------
A0A8C8U1G0_BIK-01       cgctgtca-----cctac-----agcca----------------------
                        *                        **                       

A0A6I9LW27_BCL2L11      agtgcgatggat--------------------------------------
A0A6I9LW27_BCL2L11      agtgcgatggcttccataaggcagtctcagga------------------
A0A6I9LW27_BCL2L11      agtgcgatggcttccataaggcagtctcagga------------------
A0A6J0DIY6_PMAIP1-      ----------aagcccaacgccggattcagaa------------------
A0A8C8TKK3_BBC3-01      gaggaggaggagt----------------ggg------------------
A0A6I9LQL5_BAD-01       gggacggaggaggagctcagcccctttcgggg------------------
A0A6I9LQL5_BAD-02       gggacggaggaggagctcagcccctttcgggg------------------
A0A6I9LHF8_BMF-01       gtgacagaggaaccccagagactcttttacggcaatgccggctacaggct
A0A6I9LKH4_BIK-01       --gacggggg----tcaggggcgttttcagga------------------
A0A8C8U1G0_BIK-01       --gacggggg----tcaggggcgttttcagga------------------
                                                                          

A0A6I9LW27_BCL2L11      ------------------------------------ctttgtgag-----
A0A6I9LW27_BCL2L11      ---ggaacctgcagacgttc---------------gccctgagat-----
A0A6I9LW27_BCL2L11      ---ggaacctgcagacgttc---------------gccctgagat-----
A0A6J0DIY6_PMAIP1-      -----------------------------------gacctggaag-----
A0A8C8TKK3_BBC3-01      -------------------------------------cccgggag-----
A0A6I9LQL5_BAD-01       --------ccgctcgcgttcggct---ccccccaacctctgggcc-----
A0A6I9LQL5_BAD-02       --------ccgctcgcgttcggct---ccccccaacctctgggcc-----
A0A6I9LHF8_BMF-01       tccgctccctgccagtttcccggcaggcttgcc--ccttggggagcagcc
A0A6I9LKH4_BIK-01       ----------gcctgattcgtggc---ctcaccaacctcagggaa-----
A0A8C8U1G0_BIK-01       ----------gcctgattcgtggc---ctcaccaacctcagggaa-----
                                                                *         

A0A6I9LW27_BCL2L11      ----------------------------------ac--------------
A0A6I9LW27_BCL2L11      ----------------------------------acggattgcacaggaa
A0A6I9LW27_BCL2L11      ----------------------------------acggattgcacaggaa
A0A6J0DIY6_PMAIP1-      -----------------atgagtgtgttc-------------------aa
A0A8C8TKK3_BBC3-01      --------------------atcggggcc------------------cag
A0A6I9LQL5_BAD-01       -------------gcgcagcgttacggcc----------------gcgag
A0A6I9LQL5_BAD-02       -------------gcgcagcgttacggcc----------------gcgag
A0A6I9LHF8_BMF-01       ccctgaaggacagtggcagcatc-gggcagaggtacagatcgccagaaag
A0A6I9LKH4_BIK-01       -----------------aacatt-tggtc-------------ctggagag
A0A8C8U1G0_BIK-01       -----------------aacatt-tggtc-------------ctggagag
                                                                          

A0A6I9LW27_BCL2L11      ------------------------------tctt----------------
A0A6I9LW27_BCL2L11      cttcggcggattggagacgagttcaatgagtcct----------------
A0A6I9LW27_BCL2L11      cttcggcggattggagacgagttcaatgagtcct----------------
A0A6J0DIY6_PMAIP1-      ctccggagaattggagacaaactgaattta--------------------
A0A8C8TKK3_BBC3-01      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagaca
A0A6I9LQL5_BAD-01       ctccgaaggatgagcgacgagtttgagg----gttccttcaaggga----
A0A6I9LQL5_BAD-02       ctccgaaggatgagcgacgagtttgagg----gttccttcaagggacttc
A0A6I9LHF8_BMF-01       cttcagtgcattgcagaccagtttca---------tcggcttcatataca
A0A6I9LKH4_BIK-01       tcccgactcctggcacctgggtgtta---------cctg-----------
A0A8C8U1G0_BIK-01       tcccgactcctggcacctgggtgtta---------cctg-----------
                                                                          

A0A6I9LW27_BCL2L11      ---aaaccaagagaacaaa-----------------tt--------c--a
A0A6I9LW27_BCL2L11      ---acacgaggagggctgaagaccaccctcaccaccct--------caaa
A0A6I9LW27_BCL2L11      ---acacgaggagggctgaagaccaccctcaccaccct--------caaa
A0A6J0DIY6_PMAIP1-      ----------------------------------------------tggc
A0A8C8TKK3_BBC3-01      agaa---gaacagcatcgacatcgcccctcgccc------------tgga
A0A6I9LQL5_BAD-01       -------gaagagc---------------------tggccaa----cagc
A0A6I9LQL5_BAD-02       ctcgcccaaagagcgcggggactgcaacacagatgcgacaaagcgccagc
A0A6I9LHF8_BMF-01       acaacaccagcagaaccgagaccg-------cgcgtgg--------tggc
A0A6I9LKH4_BIK-01       --------accaggcccgaggacagctgtttcccatgg--------t-gc
A0A8C8U1G0_BIK-01       --------accaggcccgaggacagctgtttcccatgg--------t-gc
                                                                          

A0A6I9LW27_BCL2L11      tggtgat-------------------------------gcacaaaaaa--
A0A6I9LW27_BCL2L11      tggttatcttacaactgttacgtttcttcatccgtctagtatggagaagg
A0A6I9LW27_BCL2L11      tggttatcttacaactgttacgtttcttcatccgtctagtatggagaagg
A0A6J0DIY6_PMAIP1-      agaaacttctgaattttatttccaagctctttaatttagtaac-------
A0A8C8TKK3_BBC3-01      gggtcatgtacaatctcttcatgggactcctccccttacccagggatcc-
A0A6I9LQL5_BAD-01       ttgagtccc---------ttctggtg------------------------
A0A6I9LQL5_BAD-02       tggacgcgcattatccagtcctggtggga----------------tcgaa
A0A6I9LHF8_BMF-01       aggtcttcctct------tcctgcaaaacctggccttgaacagagaagaa
A0A6I9LKH4_BIK-01       tgttggttctct------tgctgctgggc---------------------
A0A8C8U1G0_BIK-01       tgttggttctct------tgctgctgggc---------------------
                                                                          

A0A6I9LW27_BCL2L11      -a-----------------------------------ctgg
A0A6I9LW27_BCL2L11      ca-----------------------------------ttga
A0A6I9LW27_BCL2L11      ca-----------------------------------ttga
A0A6J0DIY6_PMAIP1-      -------------------------------------ctga
A0A8C8TKK3_BBC3-01      -------------cggagccccagaaatggagcccaactag
A0A6I9LQL5_BAD-01       ---cgtgcaatag----------------------------
A0A6I9LQL5_BAD-02       acttgggcaaaggaggctccaccccctccca------gtga
A0A6I9LHF8_BMF-01       aacagggaaggggcgggtccctg--------------gtga
A0A6I9LKH4_BIK-01       -----------ggcgaggccctgcgtttgcagcttcagtga
A0A8C8U1G0_BIK-01       -----------ggcgaggccctgcgtttgcagcttcagtga
                                                                 

© 1998-2022Legal notice