Dataset for CDS classical BH3-containing proteins of organism Peromyscus maniculatus bairdii

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A6I9LHF8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BMF (length=813 residues).
atgcccggagcgggcgtattttggaaacaataccgcgcggtgcgccgtggcctcctctcgcgccagctcgcgcctgcagc
agccgctgccctagctcgtaccaccgcctcccgccgcagcccgctggagtttgccccctccttccctatcgagtgtgggc
gccaagccccccgagtgctcgtcaccctggaccctggcgcagagccctggcatcacgactcggaggcagagactctgtcc
tggagtcacccaggagagatggagccaccgcagtgtgtggaggagctggaagatgatgtgttccagccagaggatgggga
gccagggacacaacctgggagcttgctctctgctgacctgttcgcccagagccagctggattgccccctcagccggctcc
agctcttccctctcactcattgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagc
ccagcttccccaagccagggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgccgg
ctacaggcttccgctccctgccagtttcccggcaggcttgccccttggggagcagccccctgaaggacagtggcagcatc
gggcagaggtacagatcgccagaaagcttcagtgcattgcagaccagtttcatcggcttcatatacaacaacaccagcag
aaccgagaccgcgcgtggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggc
gggtccctggtga
>gnl|bcl2dbcds|A0A6I9LKH4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BIK (length=480 residues).
atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgcatgaccaggtcccccgacctccagtggctcc
tggggctcccagcatgaaggagcccgtggaggaagaaaatattagtcctgtgagagacctggaccttgcggagtgcctgg
aggacagaaaccaggtggccctgaggctggcctacatcggtgatgagatggacctgtgtctgcggagcccccgtctggcc
cagctgcccgggattgccatgcacagactcgctgtcacctacagccagacgggggtcaggggcgttttcaggagcctgat
tcgtggcctcaccaacctcagggaaaacatttggtcctggagagtcccgactcctggcacctgggtgttacctgaccagg
cccgaggacagctgtttcccatggtgctgttggttctcttgctgctgggcggcgaggccctgcgtttgcagcttcagtga
>gnl|bcl2dbcds|A0A6I9LQL5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BAD (length=537 residues).
atgggaaccccaaagcagcccttgctggctcctgcacatgccctaggcgtgaggaagtcggatcccggaatccggagcct
ggggagcgacgcaggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagactccagtactgctgataggggcctgggcccaagcttcactggggaccaacggggtccctacctggccccaggt
ctcctggggaacatcggacaccaacaggggcaggcagccaacagcagtcatcatggaggcgttggggctatggagacccg
gagtcgccacagttcgtaccccgcggggaccgaggaggatgaagggacggaggaggagctcagcccctttcggggccgct
cgcgttcggctccccccaacctctgggccgcgcagcgttacggccgcgagctccgaaggatgagcgacgagtttgagggt
tccttcaagggagaagagctggccaacagcttgagtcccttctggtgcgtgcaatag
>gnl|bcl2dbcds|A0A6I9LQL5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BAD (length=615 residues).
atgggaaccccaaagcagcccttgctggctcctgcacatgccctaggcgtgaggaagtcggatcccggaatccggagcct
ggggagcgacgcaggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagactccagtactgctgataggggcctgggcccaagcttcactggggaccaacggggtccctacctggccccaggt
ctcctggggaacatcggacaccaacaggggcaggcagccaacagcagtcatcatggaggcgttggggctatggagacccg
gagtcgccacagttcgtaccccgcggggaccgaggaggatgaagggacggaggaggagctcagcccctttcggggccgct
cgcgttcggctccccccaacctctgggccgcgcagcgttacggccgcgagctccgaaggatgagcgacgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcggggactgcaacacagatgcgacaaagcgccagctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccctcccagtga
>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=582 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggaggcggcgaaggggaccgctgcc
cccacggcagccctcagggcccgctggccccaccggccagccctgggccttttgctaccagatccccacttttcatcttt
gtgagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagtccggcacccatgag
ttgtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccataaggc
agtctcaggaggaacctgcagacgttcgccctgagatacggattgcacaggaacttcggcggattggagacgagttcaat
gagtcctacacgaggagggctgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtttcttcatccg
tctagtatggagaaggcattga
>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=408 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccataaggcagtctcaggaggaa
cctgcagacgttcgccctgagatacggattgcacaggaacttcggcggattggagacgagttcaatgagtcctacacgag
gagggctgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtttcttcatccgtctagtatggagaa
ggcattga
>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=273 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggatctttgtgagactcttaaaccaaga
gaacaaattcatggtgatgcacaaaaaaactgg
>gnl|bcl2dbcds|A0A6J0DIY6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=PMAIP1 (length=315 residues).
atgccccggagccaggcgcgtccgaacgcgccatcgaacgcagcgtgggcagagctagcgcccgagttcgcagctcagct
caggaggatcggagacaaactgtattctgcgcggtgtgaacccgacatcactgcggtgctggcggagatgcctggcagga
aggcgcgaaagagcgcgaccaggagctcaagcccaacgccggattcagaagacctggaagatgagtgtgttcaactccgg
agaattggagacaaactgaatttatggcagaaacttctgaattttatttccaagctctttaatttagtaacctga
>gnl|bcl2dbcds|A0A8C8TKK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagaaggcttggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctccgctgtgtcctgcggcctctgcgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccggcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggcggccccacccaagcagccccgggagtgcgtggggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagaacag
catcgacatcgcccctcgccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcccggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|A0A8C8U1G0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BIK (length=456 residues).
atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgcatgaccaggtcccccgacctccagtggctcc
tggggctcccagcatgaaggagcctgtgagagacctggaccttgcggagtgcctggaggacagaaaccaggtggccctga
ggctggcctacatcggtgatgagatggacctgtgtctgcggagcccccgtctggcccagctgcccgggattgccatgcac
agactcgctgtcacctacagccagacgggggtcaggggcgttttcaggagcctgattcgtggcctcaccaacctcaggga
aaacatttggtcctggagagtcccgactcctggcacctgggtgttacctgaccaggcccgaggacagctgtttcccatgg
tgctgttggttctcttgctgctgggcggcgaggccctgcgtttgcagcttcagtga
© 1998-2022Legal notice