Dataset for CDS classical BH3-containing proteins of organism Panthera tigris altaica

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9J1B3_PMAIP1-      ---------------------tggtgttccttaagtattaagacagtcaa
A0A8C9J1B3_PMAIP1-      -------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9J6L6_BAD-01       atgt---tccagatcccag----------agtttgagcccagtgagcagg
A0A8C9IYS3_BMF-01       atgg---agccg-cctcag----------tgtgtg-----gaggagctgg
A0A8C9IYS3_BMF-02       atgg---agccg-cctcag----------tgtgtg-----gaggagctgg
                                                                          

A0A8C9J1B3_PMAIP1-      aatg-----------agccctgggagag-----------tcccccccgaa
A0A8C9J1B3_PMAIP1-      nnnn-----------nnnnnnnnnnnag----------------cccgaa
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9JC73_BCL2L11      acaa-------ttgcagcctgctgagaggcctcctcagctcaggcct---
A0A8C9J6L6_BAD-01       aaga-------ctccagccctacggataggggcctgggccccagccccac
A0A8C9IYS3_BMF-01       aggatgatgtgttccagccagaggatggggagccggggacccagcct---
A0A8C9IYS3_BMF-02       aggatgatgtgttccagccagaggatggggagccggggacccagcct---
                                                                    **    

A0A8C9J1B3_PMAIP1-      gtggaatgtgc--catgcagctccggagatttggagacaaa---------
A0A8C9J1B3_PMAIP1-      gtggaatgtgc--catgcagctccggagatttggagacaaa---------
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagcaag---------
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagcaaggtaatcctg
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagcaaggtaatcctg
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagcaaggtaatcctg
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagcaaggtaatcctg
A0A8C9JC73_BCL2L11      -ggggcc------cctacctctctacagacagagcagca-----------
A0A8C9J6L6_BAD-01       aggggaccggc--cccgcggccctgg----caagcacca-----------
A0A8C9IYS3_BMF-01       -gggagcttgctgtctgctaacctgtttgcccagagcca-----------
A0A8C9IYS3_BMF-02       -gggagcttgctgtctgctaacctgtttgcccagagcca-----------
                          **             *    *          *   **           

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      aaggcgaaggggaccgctgcccccaagg-------------cagccctca
A0A8C9JC73_BCL2L11      aaggcgaaggggaccgctgcccccaagg-------------cagccctca
A0A8C9JC73_BCL2L11      aaggcgaaggggaccgctgcccccaagg-------------cagccctca
A0A8C9JC73_BCL2L11      aaggcgaaggggaccgctgcccccaagg-------------cagccctca
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9J6L6_BAD-01       ---gc-ggacggccccaggcctcctcggggaagctggtcaccagcagggg
A0A8C9IYS3_BMF-01       ---gctggactgccc-------cctcag------------ccatc---tg
A0A8C9IYS3_BMF-02       ---gctggactgccc-------cctcag------------ccatc---tg
                                                                          

A0A8C9J1B3_PMAIP1-      -------------------------------ctgaattt-----------
A0A8C9J1B3_PMAIP1-      -------------------------------ctgaattt-----------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      gggcccgctggccccaccagcca-----gccccgggccttttgctaccag
A0A8C9JC73_BCL2L11      gggcccgctggccccaccagcca-----gccccgggccttttgctaccag
A0A8C9JC73_BCL2L11      gggcccgctggccccaccagcca-----gccccgggccttttgctaccag
A0A8C9JC73_BCL2L11      gggcccgctggccccaccagcca-----gccccgggccttttgctaccag
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9J6L6_BAD-01       cagcccgccagcagcaaccaccatggaggcgctggggctgtggagacc--
A0A8C9IYS3_BMF-01       cagctcttccctctcacccactgctgtggtcctgggctt----cgacc--
A0A8C9IYS3_BMF-02       cagctcttccctctcacccactgctgtggtcctgggctt----cgacc--
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      atccccgcttttcatctttgtcagaagatcctccctgct-----------
A0A8C9JC73_BCL2L11      atccccgcttttcatctttgtcagaagatcctccctgct-----------
A0A8C9JC73_BCL2L11      atccccgcttttcatctttgtcagaagatcctccctgct-----------
A0A8C9JC73_BCL2L11      atccccgcttttcatctttgtcagaagatcctccctgct-----------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9J6L6_BAD-01       ------------cggagtcgccacagctcgtaccccgccgggaccgagga
A0A8C9IYS3_BMF-01       ------------ca-------------------ccagcc-----------
A0A8C9IYS3_BMF-02       ------------ca-------------------ccagcc-----------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      ------------------------gtctcgatcctccagtgggtatttct
A0A8C9JC73_BCL2L11      ------------------------gtctcgatcctccagtgggtatttct
A0A8C9JC73_BCL2L11      ------------------------gtctcgatcctccagtgggtatttct
A0A8C9JC73_BCL2L11      ------------------------gtctcgatcctccagtgggtatttct
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9J6L6_BAD-01       ggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgc
A0A8C9IYS3_BMF-01       --------------aggaagacaaggccaccc------------------
A0A8C9IYS3_BMF-02       --------------aggaagacaaggccaccc------------------
                                                                          

A0A8C9J1B3_PMAIP1-      ---------ccgacagaagctt----------------------------
A0A8C9J1B3_PMAIP1-      ---------ccgacagaagctt----------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      cttttgacacagacaggagcccggcacccatgagttgtgac---------
A0A8C9JC73_BCL2L11      cttttgacacagacaggagcccggcacccatgagttgtgac---------
A0A8C9JC73_BCL2L11      cttttgacacagacaggagcccggcacccatgagttgtgac---------
A0A8C9JC73_BCL2L11      cttttgacacagacaggagcccggcacccatgagttgtgac---------
A0A8C9JC73_BCL2L11      ----------agacaggagcccggcacccatgagttgtgac---------
A0A8C9J6L6_BAD-01       gctcagcgccccccaacctctgggccgccctgcgctacggccgcgagctc
A0A8C9IYS3_BMF-01       ------agaccctcagtcc---ggcctccccgagtcagggtgtcatgctg
A0A8C9IYS3_BMF-02       ------agaccctcagtcc---ggcctccccgagtcagggtgtcatgctg
                                                                          

A0A8C9J1B3_PMAIP1-      ---------atgaatctgatatccaaa---ctcttccgctcgggaacctg
A0A8C9J1B3_PMAIP1-      ---------atgaatctgatatccaaa---ctcttccgctcgggaacctg
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      -------aaatcaacacaaaccccaag----tcctccttgccaggccttc
A0A8C9JC73_BCL2L11      -------aaatcaacacaaaccccaag----tcctccttgccaggccttc
A0A8C9JC73_BCL2L11      -------aaatcaacacaaaccccaag----tcctccttgccaggccttc
A0A8C9JC73_BCL2L11      -------aaatcaacacaaaccccaag----tcctccttgccaggccttc
A0A8C9JC73_BCL2L11      -------aaatcaacacaaaccccaag----tcctccttgccaggccttc
A0A8C9J6L6_BAD-01       c---ggaggatgagcgacgagttccag-ggctccttcaagaagggacttc
A0A8C9IYS3_BMF-01       ccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctgg
A0A8C9IYS3_BMF-02       ccttgtggggtgaccgaagaaccccagcgactcttttatg----------
                                                                          

A0A8C9J1B3_PMAIP1-      a-------------------------------------------------
A0A8C9J1B3_PMAIP1-      a-------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      a-------------------------------------------------
A0A8C9JC73_BCL2L11      a-------------------------------------------------
A0A8C9JC73_BCL2L11      a-------------------------------------------------
A0A8C9JC73_BCL2L11      a-------------------------------------------------
A0A8C9JC73_BCL2L11      a-------------------------------------------------
A0A8C9J6L6_BAD-01       c-------------------------------------------------
A0A8C9IYS3_BMF-01       ctaccggctccctctccctgccagtttccctgcaggcttgccccttggtg
A0A8C9IYS3_BMF-02       --------------------------------------------------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      ------------------accattatctcagtgcaatgg-----------
A0A8C9JC73_BCL2L11      ------------------accattatctcagtgcaatgg-----------
A0A8C9JC73_BCL2L11      ------------------accattatctcagtgcaat-------------
A0A8C9JC73_BCL2L11      ------------------accattatctcagtgcaatgg-----------
A0A8C9JC73_BCL2L11      ------------------accattatctcagtgcaatgg-----------
A0A8C9J6L6_BAD-01       -----acgcccgaagagcgcgggcacagcgacgcagatg-----------
A0A8C9IYS3_BMF-01       agcagccccctgaagggcattggcagcatcgagcagaggtacagattgcc
A0A8C9IYS3_BMF-02       --------------------------------------------------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9J6L6_BAD-01       --------------------------------------------------
A0A8C9IYS3_BMF-01       cgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagca
A0A8C9IYS3_BMF-02       --------------------------------------------------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      -cttccatgaggcagcctcaggctgtacccgcagatatgcgcccggagat
A0A8C9JC73_BCL2L11      -tt-----------------------------------------agagca
A0A8C9JC73_BCL2L11      -cttccatgaggcagcctcaggctgtacccgcagatatgcgcccggagat
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      -cttccatgaggcagcctcaggctgtacccgcagatatgcgcccggagat
A0A8C9JC73_BCL2L11      -cttccatgaggcagcctcaggctgtacccgcagatatgcgcccggagat
A0A8C9J6L6_BAD-01       ----cggcaaagccccagctggacgcg------------cttcatcc---
A0A8C9IYS3_BMF-01       acaccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctac
A0A8C9IYS3_BMF-02       -caccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctac
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      atggattgcacaagagttgcggc-------gtatcggagacgaatttaat
A0A8C9JC73_BCL2L11      atag----------------------------------------------
A0A8C9JC73_BCL2L11      atggattgcacaagagttgcggc-------gtatcggagacgaatttaat
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      atggattgcacaagagttgcggc-------gtatcggagacgaatttaat
A0A8C9JC73_BCL2L11      atggattgcacaagagttgcggc-------gtatcggagacgaatttaat
A0A8C9J6L6_BAD-01       --------------agtcctggtgggatcggaacttggggagaggaggct
A0A8C9IYS3_BMF-01       acaacctggctttgaatgcagaagagaacaggaatggggcagg-------
A0A8C9IYS3_BMF-02       acaacctggctttgaatgcagaagagaacaggaatggggcagg-------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      gcatattacccaaggagg-----ctggcaagagtaccg------------
A0A8C9JC73_BCL2L11      ------------aggaaggtgtcctgtag---------------------
A0A8C9JC73_BCL2L11      gcatattacccaaggagg-----ttagagcaatag---------------
A0A8C9JC73_BCL2L11      ----------------gggtctttttgaataa------------------
A0A8C9JC73_BCL2L11      gcatattacccaaggagggtctttttgaataattaccaagcagccgaagc
A0A8C9JC73_BCL2L11      gcatattacccaaggagggtctttttgaataattaccaagcagccgaagc
A0A8C9J6L6_BAD-01       ccgccccctcccag-tga--------------------------------
A0A8C9IYS3_BMF-01       --------tcccaggtga--------------------------------
A0A8C9IYS3_BMF-02       --------tcccag------------------------------------
                                                                          

A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9J1B3_PMAIP1-      --------------------------------------------------
A0A8C9JC73_BCL2L11      -----------------------------------gcatcctacatctga
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      ccagccccaaatgattatcttacgactgttacgttacatcgtccgcctga
A0A8C9JC73_BCL2L11      ccagccccaaatgattatcttacgactgttacgttacatcgtccgcctga
A0A8C9J6L6_BAD-01       --------------------------------------------------
A0A8C9IYS3_BMF-01       --------------------------------------------------
A0A8C9IYS3_BMF-02       --------------------------------------------------
                                                                          

A0A8C9J1B3_PMAIP1-      -----------------
A0A8C9J1B3_PMAIP1-      -----------------
A0A8C9JC73_BCL2L11      -----------------
A0A8C9JC73_BCL2L11      -----------------
A0A8C9JC73_BCL2L11      -----------------
A0A8C9JC73_BCL2L11      -----------------
A0A8C9JC73_BCL2L11      tatggcgattgcagcga
A0A8C9JC73_BCL2L11      tatggcgattgcagcga
A0A8C9J6L6_BAD-01       -----------------
A0A8C9IYS3_BMF-01       -----------------
A0A8C9IYS3_BMF-02       -----------------
                                         

© 1998-2022Legal notice