Dataset for CDS classical BH3-containing proteins of organism Panthera tigris altaica

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C9IYS3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Panthera tigris altaica GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C9IYS3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Panthera tigris altaica GN=BMF (length=390 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatgcaccagcaaaaccgccgtcgagtgtggt
ggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccag
>gnl|bcl2dbcds|A0A8C9J1B3_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Panthera tigris altaica GN=PMAIP1 (length=156 residues).
tggtgttccttaagtattaagacagtcaaaatgagccctgggagagtcccccccgaagtggaatgtgccatgcagctccg
gagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaacctga
>gnl|bcl2dbcds|A0A8C9J1B3_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Panthera tigris altaica GN=PMAIP1 (length=165 residues).
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcccgaagtggaatgtgccat
gcagctccggagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaa
cctga
>gnl|bcl2dbcds|A0A8C9J6L6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Panthera tigris altaica GN=BAD (length=510 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccac
aggggaccggccccgcggccctggcaagcaccagcggacggccccaggcctcctcggggaagctggtcaccagcaggggc
agcccgccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggacc
gaggaggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggc
cgccctgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagaagggacttccacgcccga
agagcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttg
gggagaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctgatatggcgattgcagcga
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctgatatggcgattgcagcga
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=411 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagagcaatagaggaag
gtgtcctgtag
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A8C9JC73_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagcctcaggctgtacccgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaaggaggctggca
agagtaccggcatcctacatctga
© 1998-2022Legal notice