Dataset for CDS classical BH3-containing proteins of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

20 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8ZXD2_BIK-01       atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
A0A2R9AKC9_PMAIP1-      atgcctggg-----------------------------------------
A0A2R9AKC9_PMAIP1-      atgcctggg-----------------------------------------
A0A2R9BS98_BMF-01       atgg---agcca--------------------------------------
A0A2R9BS98_BMF-02       atgg---agcca--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZX9_BCL2L11      atggcaaagcaa--------------------------------------
A0A2R9BZA9_BBC3-01      atg-----------------------------------------------
A0A2R9BZA9_BBC3-02      atg-----------------------------------------------
A0A2R8Z674_BAD-02       atgttccag-----------------------------------------
A0A2R8Z674_BAD-01       atgttccag-----------------------------------------
A0A2R8Z674_BAD-03       atgttccag-----------------------------------------

A0A2R8ZXD2_BIK-01       gtatgagcagctcctggaacccccgaccatggaggttcttggcgtg----
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       ---------------------tc-------------tcagtgtgtg----
A0A2R9BS98_BMF-02       ---------------------tc-------------tcagtgtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZX9_BCL2L11      ---------------------ccttctgatgtaagttctgagtgtg----
A0A2R9BZA9_BBC3-01      ---------------------------------------aaatttg----
A0A2R9BZA9_BBC3-02      ---------------------------------------aaatttg----
A0A2R8Z674_BAD-02       ---------------------------------atcccagagtttgagcc
A0A2R8Z674_BAD-01       ---------------------------------atcccagagtttgagcc
A0A2R8Z674_BAD-03       ---------------------------------atcccagagtttgagcc

A0A2R8ZXD2_BIK-01       -actgagtctgaggaggac---ctggaccctatggaggacttcgattctt
A0A2R9AKC9_PMAIP1-      ----aagaaggcgcgcaa--------------------------------
A0A2R9AKC9_PMAIP1-      ----aagaaggcgcgcaa--------------------------------
A0A2R9BS98_BMF-01       -gaggagctggaggatgatgtgttccaaccagagga--------------
A0A2R9BS98_BMF-02       -gaggagctggaggatgatgtgttccaaccagagga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZX9_BCL2L11      -accgagaaggtagacaa----ttgcagcctgcgga--------------
A0A2R9BZA9_BBC3-01      ----------------------------------gc--------------
A0A2R9BZA9_BBC3-02      ----------------------------------gc--------------
A0A2R8Z674_BAD-02       gagtgagcaggaagac------tccagctctgcaga--------------
A0A2R8Z674_BAD-01       gagtgagcaggaagac------tccagctctgcaga--------------
A0A2R8Z674_BAD-03       gagtgagcaggaagac------tccagctctgcaga--------------

A0A2R8ZXD2_BIK-01       tggagtgcatggagggcagtgacgcgttggccctgcggctggcctgcatc
A0A2R9AKC9_PMAIP1-      ----gaacgctcaaccgagccccg-------------cgcgggctccagc
A0A2R9AKC9_PMAIP1-      ----gaacgctcaaccgagccccg-------------cgcgggctccagc
A0A2R9BS98_BMF-01       -tggggagccggtgacccaacccg--------gga--gcttgctctctgc
A0A2R9BS98_BMF-02       -tggggagccggtgacccaacccg--------gga--gcttgctctctgc
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZX9_BCL2L11      -gaggcctccccagctcagacctg--------gggcccctacctccctac
A0A2R9BZA9_BBC3-01      -atggggtctg---cccaggcatg--------------------tcca--
A0A2R9BZA9_BBC3-02      -atggggtctg---cccaggcatg--------------------tcca--
A0A2R8Z674_BAD-02       -gaggggcctgggccccagccccgcaggggacgggccctcgggctccagc
A0A2R8Z674_BAD-01       -gaggggcctgggccccagccccgcaggggacgggccctcgggctccagc
A0A2R8Z674_BAD-03       -gaggggcctgggccccagccccgcaggggacgggccctcgggctccagc
                            *                  *                      *   

A0A2R8ZXD2_BIK-01       gg---ggacgagatggacgtgagcc-tcagg-------------------
A0A2R9AKC9_PMAIP1-      ag------------------------------------------------
A0A2R9AKC9_PMAIP1-      aggaccggcgggtacggcgagggac--caag-------------------
A0A2R9BS98_BMF-01       tg-----acctgtttgcccagagcctactgg-------------------
A0A2R9BS98_BMF-02       tg-----acctgtttgcccagagcctactgg-------------------
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaag-------------------
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaag-------------------
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaag-------------------
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-aca---------------------
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZX9_BCL2L11      ag-----a----------cagagcc-acaaggtaatcctgaaggcaatca
A0A2R9BZA9_BBC3-01      --------------tgccaggtgcc--cagg-------------------
A0A2R9BZA9_BBC3-02      --------------tgccaggtgcc--cagg-------------------
A0A2R8Z674_BAD-02       aa-----gcatcatcgccag--gcc--ccag-------------------
A0A2R8Z674_BAD-01       aa-----gcatcatcgccag--gcc--ccag-------------------
A0A2R8Z674_BAD-03       aa-----gcatcatcgccag--gcc--ccag-------------------

A0A2R8ZXD2_BIK-01       -----------------gccccgcgcctggcccagctctccgacgtggcc
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      ---------------------------------------------ccgga
A0A2R9BS98_BMF-01       -----------------actgccccctcagccgacttcagctcttccctc
A0A2R9BS98_BMF-02       -----------------actgccccctcagccgacttcagctcttccctc
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZX9_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcag---ggcccgc
A0A2R9BZA9_BBC3-01      -----------------gctgcttccgtgacgtgggtcc------cctgc
A0A2R9BZA9_BBC3-02      -----------------gctgcttccgtgacgtgggtcc------cctgc
A0A2R8Z674_BAD-02       -----------------gcctcctgtgggacgccagtca------ccagc
A0A2R8Z674_BAD-01       -----------------gcctcctgtgggacgccagtca------ccagc
A0A2R8Z674_BAD-03       -----------------gcctcctgtgggacgccagtca------ccagc

A0A2R8ZXD2_BIK-01       atgcacagc-----ctgggtctggctttcatct-----------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      tttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttc
A0A2R9BS98_BMF-01       tcacccact--gctgtggccctggccttc---------------------
A0A2R9BS98_BMF-02       tcacccact--gctgtggccctggccttc---------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZX9_BCL2L11      tggccccac--cggccagccctggcccttttgctaccagatccccgcttt
A0A2R9BZA9_BBC3-01      cagatttgtggtcctcagccctcgctctcgctggcggagcagcacctgga
A0A2R9BZA9_BBC3-02      cagatttgt-----------------------------------------
A0A2R8Z674_BAD-02       aggagcagc--caaccagcagcagccatcatggagaagggacttcct---
A0A2R8Z674_BAD-01       aggagcagc--caaccagcagcagccatcatg------------------
A0A2R8Z674_BAD-03       aggagcagc--caaccagcagcagccatcatggagggagaacttcgtatt

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      ctcctcttcctcctcgccacttgcccttccccggggccac----------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZX9_BCL2L11      tcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2R9BZA9_BBC3-01      gtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccagg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R8Z674_BAD-02       --------------------------------------------------
A0A2R8Z674_BAD-01       --------------------------------------------------
A0A2R8Z674_BAD-03       ctccttcttg-------------------------------ggaatctga

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZX9_BCL2L11      ttctcttttgac--------------------------------------
A0A2R9BZA9_BBC3-01      cggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R8Z674_BAD-02       --------------------------------------------------
A0A2R8Z674_BAD-01       --------------------------------------------------
A0A2R8Z674_BAD-03       ggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcaggga

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      gcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R8Z674_BAD-02       --------------------------------cgcccgaagagcgc----
A0A2R8Z674_BAD-01       --------------------------------------------------
A0A2R8Z674_BAD-03       tgtccgccccagccgctgactcagaagcccaacacgcagagaatgt----

A0A2R8ZXD2_BIK-01       acgaccagactgaggacatcagggatgttcttagaagtttcatggacggt
A0A2R9AKC9_PMAIP1-      -----------------agctg-----------gaagtcgagtgtgctac
A0A2R9AKC9_PMAIP1-      gaggaacaagcgcaagtagctg-----------gaagtcgagtgtgctac
A0A2R9BS98_BMF-01       ---------gacccaccagcca-ggaa----gacaaagctacccagaccc
A0A2R9BS98_BMF-02       ---------gacccaccagcca-ggaa----gacaaagctacccagaccc
A0A2R9BZX9_BCL2L11      ----acaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      ----acaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      --agacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZX9_BCL2L11      acagacaggagcccagcaccca-tgagttgtgacaaatcaacacaaaccc
A0A2R9BZA9_BBC3-01      gagacaagaggagcagcagcgg-------------------caccgcccc
A0A2R9BZA9_BBC3-02      gagacaagaggagcagcagcgg-------------------caccgcccc
A0A2R8Z674_BAD-02       gggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttcc
A0A2R8Z674_BAD-01       -------gaggcgctggggctgtggagatccgg--agtcgccacagctcc
A0A2R8Z674_BAD-03       aaagctagaggcgctggggctgtggagatccgg--agtcgccacagctcc

A0A2R8ZXD2_BIK-01       ttcaccacacttaaggagaacataatgaggttctgg--------------
A0A2R9AKC9_PMAIP1-      t-----caactcaggagatttggag--acaaactga----acttccggca
A0A2R9AKC9_PMAIP1-      t-----caactcaggagatttggag--acaaactga----acttccggca
A0A2R9BS98_BMF-01       tcagcccagcct------cccccagccaaggtgtcatgctgccttgtggg
A0A2R9BS98_BMF-02       tcagcccagcct------cccccagccaaggtgtcatgctgccttgtggg
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZX9_BCL2L11      caagtcctccttgccaggccttcaaccactatctca---------gtgca
A0A2R9BZA9_BBC3-01      t-----cgccctggagggtcctgtacaatctcatca----------tg--
A0A2R9BZA9_BBC3-02      t-----cgccctggagggtcctgtacaatctcatca----------tg--
A0A2R8Z674_BAD-02       a-----gtcctggtgggatcg--------gaacttg----------ggca
A0A2R8Z674_BAD-01       t-----accccgcggggacggaggacgacgaaggga----------tggg
A0A2R8Z674_BAD-03       t-----accccgcggggacggaggacgacgaaggga----------tggg

A0A2R8ZXD2_BIK-01       --------------agatccccgaaccccaggtcctgg------------
A0A2R9AKC9_PMAIP1-      gaaacttctgaatctgatatccaaactcttctgctcag------------
A0A2R9AKC9_PMAIP1-      gaaacttctgaatctgatatccaaactcttctgctcag------------
A0A2R9BS98_BMF-01       gtgactg-------aggaaccccagcgactcttttatggcaatgctggct
A0A2R9BS98_BMF-02       gtgactg-------aggaaccccagcgactcttttatg------------
A0A2R9BZX9_BCL2L11      atggtagtcatcctagaggatataggtgatctttcact------------
A0A2R9BZX9_BCL2L11      atgg-----at------gactccgctggatcct-----------------
A0A2R9BZX9_BCL2L11      ----cttccat------gaggcaggctgaacctgcaga------------
A0A2R9BZX9_BCL2L11      atggtt--------------------------------------------
A0A2R9BZX9_BCL2L11      at------------------------------------------------
A0A2R9BZX9_BCL2L11      atggcttccat------gaggcaggctgaacctgcaga------------
A0A2R9BZX9_BCL2L11      atggcttccat------gaggcaggctgaacctgcaga------------
A0A2R9BZX9_BCL2L11      atggcttccat------gaggcaggctgaacctgcaga------------
A0A2R9BZX9_BCL2L11      atggcttccat------gaggcaggctgaacctgcaga------------
A0A2R9BZX9_BCL2L11      atggc---------------------------------------------
A0A2R9BZA9_BBC3-01      ---g-------------gactcctgcccttacccaggg------------
A0A2R9BZA9_BBC3-02      ---g-------------gactcctgcccttacccaggg------------
A0A2R8Z674_BAD-02       gggg-------------aagctccgccccctcc---ca------------
A0A2R8Z674_BAD-01       ggag-------------gagcccagcccctttc--ggg------------
A0A2R8Z674_BAD-03       ggag-------------gagcccagcccctttc--ggg------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       atcggcttcctctccctgccagtttcccagcagtcttgcccattggggag
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R8Z674_BAD-02       --------------------------------------------------
A0A2R8Z674_BAD-01       --------------------------------------------------
A0A2R8Z674_BAD-03       --------------------------------------------------

A0A2R8ZXD2_BIK-01       --------------------------gtgtcccgcgaacaggtgctgctg
A0A2R9AKC9_PMAIP1-      ---------------------------------gaacctga---------
A0A2R9AKC9_PMAIP1-      ---------------------------------gaacctgactgcatcaa
A0A2R9BS98_BMF-01       cagccccccgaagggcagtggcaacatcgagcagaggtacagattgcccg
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      -----------------------gtgctttggatttatatttactggctt
A0A2R9BZX9_BCL2L11      ---------------------------------------------ccctc
A0A2R9BZX9_BCL2L11      -----------------------tatgcgcccggagatatggatcgccca
A0A2R9BZX9_BCL2L11      --------------------------------agagaaataga------g
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      -----------------------tatgcgcccggagatatggatcgccca
A0A2R9BZX9_BCL2L11      -----------------------tatgcgcccggagatatggatcgccca
A0A2R9BZX9_BCL2L11      -----------------------tatgcgcccggagatatggatcgccca
A0A2R9BZX9_BCL2L11      -----------------------tatgcgcccggagatatggatcgccca
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------gcca--------cagagcccccga
A0A2R9BZA9_BBC3-02      --------------------------gcca--------cagagcccccga
A0A2R8Z674_BAD-02       --------------------------gtgactttcgctccacatcccgaa
A0A2R8Z674_BAD-01       --------------------------gccgctcgcgctcggcgcccccca
A0A2R8Z674_BAD-03       --------------------------gccgctcgcgctcggcgcccccca

A0A2R8ZXD2_BIK-01       gcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcct
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      aaacttgcatgaggggactccttc-aaaagagttttctcaggaggtgcac
A0A2R9BS98_BMF-01       aaagcttcagtg----cattgcag-accagttccaccggcttcatgtgca
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9BZX9_BCL2L11      agatttgtatggccaccaccatag-tcaagatgca---------------
A0A2R9BZX9_BCL2L11      agaattgccctt----cataggga----agttcag---------------
A0A2R9BZX9_BCL2L11      agagttgcggcg----tatcggag-acgagtttaa---------------
A0A2R9BZX9_BCL2L11      gaagttgtcgtg----tag-------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      agagttgcggcg----tatcggag-acgagtttaa---------------
A0A2R9BZX9_BCL2L11      agagttgcggcg----tatcggag-acgagtttaa---------------
A0A2R9BZX9_BCL2L11      agagttgcggcg----tatcggag-acgagtttaa---------------
A0A2R9BZX9_BCL2L11      agagttgcggcg----tatcggag-acgagtttaa---------------
A0A2R9BZX9_BCL2L11      ----------------taactggg-actag--------------------
A0A2R9BZA9_BBC3-01      ga--------------------tg-g--agccca-----attag------
A0A2R9BZA9_BBC3-02      ga--------------------tg-g--agccca-----attaggtgcct
A0A2R8Z674_BAD-02       actccacccgttcccactgccctg-ggcagc-catcttgaatatgggcgg
A0A2R8Z674_BAD-01       ac-----------------ctctg-ggcagcacagc---gctatggccgc
A0A2R8Z674_BAD-03       ac-----------------ctctg-ggcagcacagc---gctatggccgc

A0A2R8ZXD2_BIK-01       gcacctgctgctcaagtga-------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      gtttcatcaatttgaagaaagactgcattgtaattgg-------------
A0A2R9BS98_BMF-01       gcaacaccagcagaaccaaaatcgtgtgtggtggcagatcctcctcttcc
A0A2R9BS98_BMF-02       ----caccagcagaaccaaaatcgtgtgtggtggcagatcctcctcttcc
A0A2R9BZX9_BCL2L11      ----gaacaactcaaccacaa-------ggat----------------tt
A0A2R9BZX9_BCL2L11      ----tggccact----caagt-------ggttagcaaaatca--------
A0A2R9BZX9_BCL2L11      ----cgcttactatgcaagga-------ggctggcaaaactcctgtcctc
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      ----------------------------gggt------attttt------
A0A2R9BZX9_BCL2L11      ----cgcttactatgcaagga-------gggt------attttt------
A0A2R9BZX9_BCL2L11      ----cgcttactatgcaagga-------gggt------attttt------
A0A2R9BZX9_BCL2L11      ----cgcttactatgcaagga-------ggat------gcctcttccacc
A0A2R9BZX9_BCL2L11      ----cgcttactatgcaagga-------ggtt---------------aga
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R9BZA9_BBC3-02      gcacccgcccggtggacgtcagggactcggggggcaggcccctcccacct
A0A2R8Z674_BAD-02       aagtacttccctcaggcctatgcaaaaagaggatccgtgct---------
A0A2R8Z674_BAD-01       gag-------ctccggaggatgagtgacgagtttgtggactcctttaaga
A0A2R8Z674_BAD-03       gag-------ctccggaggatga---------------------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       tgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccct
A0A2R9BS98_BMF-02       tgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccct
A0A2R9BZX9_BCL2L11      ctcatga-------------------------------------------
A0A2R9BZX9_BCL2L11      -agctaa-------------------------------------------
A0A2R9BZX9_BCL2L11      cacctga-------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      -gaataa-------------------------------------------
A0A2R9BZX9_BCL2L11      -gaataattaccaagcagccgaagaccacccacgaatggttatcttacga
A0A2R9BZX9_BCL2L11      -gaataattaccaagcagccgaagaccacccacgaatggttatcttacga
A0A2R9BZX9_BCL2L11      tgattaa-------------------------------------------
A0A2R9BZX9_BCL2L11      gaaatag-------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R9BZA9_BBC3-02      cctgacaccctggccagcgcgggggactttctctgcaccatgtag-----
A0A2R8Z674_BAD-02       ---gtctcctttggagggagggc----------tgacccagattc-----
A0A2R8Z674_BAD-01       agggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaa
A0A2R8Z674_BAD-03       --------------------------------------------------

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       aggtga--------------------------------------------
A0A2R9BS98_BMF-02       ag------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      ctgttacgttacattgtccgcctggtgtggagaatgcattga--------
A0A2R9BZX9_BCL2L11      ctgttacgttacattgtccgcctggtgtggagaatgcattga--------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R8Z674_BAD-02       -------------------ccttccggtgcgtgtga--------------
A0A2R8Z674_BAD-01       agctccagctggacgcgagtcttccagtcctggtgggatcggaacttggg
A0A2R8Z674_BAD-03       --------------------------------------------------

A0A2R8ZXD2_BIK-01       ----------------------------
A0A2R9AKC9_PMAIP1-      ----------------------------
A0A2R9AKC9_PMAIP1-      ----------------------------
A0A2R9BS98_BMF-01       ----------------------------
A0A2R9BS98_BMF-02       ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZX9_BCL2L11      ----------------------------
A0A2R9BZA9_BBC3-01      ----------------------------
A0A2R9BZA9_BBC3-02      ----------------------------
A0A2R8Z674_BAD-02       ----------------------------
A0A2R8Z674_BAD-01       caggggaagctccgccccctcccagtga
A0A2R8Z674_BAD-03       ----------------------------

© 1998-2021Legal notice