Dataset for CDS classical BH3-containing proteins of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8ZXD2_BIK-01       atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
A0A2R9AKC9_PMAIP1-      atg---------------------------cctgggaagaagg-cgcgca
A0A2R9AKC9_PMAIP1-      atg---------------------------cctgggaagaagg-cgcgca
A0A2R9BS98_BMF-01       atgg---agcca----tc-------------tcagtgtgtgga-ggagct
A0A2R9BS98_BMF-02       atgg---agcca----tc-------------tcagtgtgtgga-ggagct
A0A2R9C366_BCL2L11      atggcaaagcaa----ccttctgatgtaagttctgagtgtgac-cgagaa
A0A2R9C366_BCL2L11      atggcaaagcaa----ccttctgatgtaagttctgagtgtgac-cgagaa
A0A2R9BZA9_BBC3-01      atg------------------------aaatttggcatggggtctgccca
A0A2R8Z688_BAD-01       atgttccagatc----cc--------agagtttgagccgag---tgagca
A0A2R8Z688_BAD-03       atgttccagatc----cc--------agagtttgagccgag---tgagca
                        ***                                   *           

A0A2R8ZXD2_BIK-01       gtatgagcagctcctggaacccccgaccatggaggttcttggcgtgactg
A0A2R9AKC9_PMAIP1-      agaacg--------ctcaacc----------gagccccgcgc--------
A0A2R9AKC9_PMAIP1-      agaacg--------ctcaacc----------gagccccgcgc--------
A0A2R9BS98_BMF-01       ggaggatgatgtgttccaacc-agaggatggggagccggtgacccaaccc
A0A2R9BS98_BMF-02       ggaggatgatgtgttccaacc-agaggatggggagccggtgacccaaccc
A0A2R9C366_BCL2L11      ggtagacaa----ttgcagcc-tgcggagaggcctccccagctcagacct
A0A2R9C366_BCL2L11      ggtagacaa----ttgcagcc-tgcggagaggcctccccagctcagacct
A0A2R9BZA9_BBC3-01      ggcatg-------tccatgcc--------aggtgcccagggct--gcttc
A0A2R8Z688_BAD-01       ggaaga-------ctccagctctgcagagaggggcctgggccccagcccc
A0A2R8Z688_BAD-03       ggaaga-------ctccagctctgcagagaggggcctgggccccagcccc
                                           *           *                  

A0A2R8ZXD2_BIK-01       agtctgaggaggacctggaccctatggagg----------acttcgattc
A0A2R9AKC9_PMAIP1-      -----------------gggctccagcaggaccggcgggtacggcgaggg
A0A2R9AKC9_PMAIP1-      -----------------gggctccagcag---------------------
A0A2R9BS98_BMF-01       --------ggga--gcttgctctctgctg-----------acctgtttgc
A0A2R9BS98_BMF-02       --------ggga--gcttgctctctgctg-----------acctgtttgc
A0A2R9C366_BCL2L11      --------ggggcccctacctccctacag-----------a---------
A0A2R9C366_BCL2L11      --------ggggcccctacctccctacag-----------a---------
A0A2R9BZA9_BBC3-01      --------cgtgacgtgggtcccctgcca-----------gatttgt---
A0A2R8Z688_BAD-01       gcaggggacgggccctcgggctccagcaa-----------gcatcatcg-
A0A2R8Z688_BAD-03       gcaggggacgggccctcgggctccagcaa-----------gcatcatcg-
                                                                          

A0A2R8ZXD2_BIK-01       tttggagtgca---------------------------------------
A0A2R9AKC9_PMAIP1-      accaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaa
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       ccagagcc------------------------------------------
A0A2R9BS98_BMF-02       ccagagcc------------------------------------------
A0A2R9C366_BCL2L11      -cagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggacag
A0A2R9C366_BCL2L11      -cagagccaca---------------------------------------
A0A2R9BZA9_BBC3-01      ---ggtcctca---------------------------------------
A0A2R8Z688_BAD-01       -ccaggcccca---------------------------------------
A0A2R8Z688_BAD-03       -ccaggcccca---------------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       -----------tggagggcagtgacgcgttggccctgcggctggcctgca
A0A2R9AKC9_PMAIP1-      aagctcctttcctcctcttcctcctcgccactt---gcccttccccgggg
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       ----------------------tactggactgc---cccctcagccgact
A0A2R9BS98_BMF-02       ----------------------tactggactgc---cccctcagccgact
A0A2R9C366_BCL2L11      ctgcccccacggcagccctcagggcccgctggc---cccaccggccagcc
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      -gccctc----------gctctcgctggc-gga---gcagc--acctgga
A0A2R8Z688_BAD-01       -ggcctcctgtgggacgccagtcaccagcagga---gcagccaaccagca
A0A2R8Z688_BAD-03       -ggcctcctgtgggacgccagtcaccagcagga---gcagccaaccagca
                                                                          

A0A2R8ZXD2_BIK-01       tcgg----------------------------------------------
A0A2R9AKC9_PMAIP1-      cca-----------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       tcagctcttcc---------------------------------------
A0A2R9BS98_BMF-02       tcagctcttcc---------------------------------------
A0A2R9C366_BCL2L11      ctggcccttttg--------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      gtcgcc--cgtg--------------------------------------
A0A2R8Z688_BAD-01       gcagccatcatg--------------------------------------
A0A2R8Z688_BAD-03       gcagccatcatggagggagaacttcgtattctccttcttgggaatctgag
                                                                          

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-03       gactctgaaaatcccagtgcagggatgctcgcggaagcatcagcagggat
                                                                          

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------cgaggaacaagc
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       -------------------------------------------ctctcac
A0A2R9BS98_BMF-02       -------------------------------------------ctctcac
A0A2R9C366_BCL2L11      ---------ctaccagatccccgcttttcatctttatgagaagatcctcc
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ------------------------------------------------cc
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-03       gtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaagc
                                                                          

A0A2R8ZXD2_BIK-01       -ggacgagatggacgtg-----------------------agcctcaggg
A0A2R9AKC9_PMAIP1-      gcaagtagctggaagtcgagtgtg----------ctactcaactcaggag
A0A2R9AKC9_PMAIP1-      ------agctggaagtcgagtgtg----------ctactcaactcaggag
A0A2R9BS98_BMF-01       ccactgctgtggccct-------------------------ggccttcga
A0A2R9BS98_BMF-02       ccactgctgtggccct-------------------------ggccttcga
A0A2R9C366_BCL2L11      ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggag
A0A2R9C366_BCL2L11      -----------------------------------------agacaggag
A0A2R9BZA9_BBC3-01      cagcgccccgggggctctggcggg-cggtcccacccaggcggccccggga
A0A2R8Z688_BAD-01       --gaggcgctggggctgtggagatccggagtcgcc---acagctcc--ta
A0A2R8Z688_BAD-03       tagaggcgctggggctgtggagatccggagtcgcc---acagctcc--ta
                                                                          

A0A2R8ZXD2_BIK-01       ccccgcgcctggcccagctctccgacgtggccatgcacagcctgggtctg
A0A2R9AKC9_PMAIP1-      atttggagacaaactgaacttccggcagaaacttctgaatctgatatcca
A0A2R9AKC9_PMAIP1-      atttggagacaaactgaacttccggcagaaacttctgaatctgatatcca
A0A2R9BS98_BMF-01       cccaccagcca----ggaa----gacaaagctacccagaccctcagccca
A0A2R9BS98_BMF-02       cccaccagcca----ggaa----gacaaagctacccagaccctcagccca
A0A2R9C366_BCL2L11      cccagcaccca----tgagttgtgacaaatcaacacaaaccccaagtc--
A0A2R9C366_BCL2L11      cccagcaccca----tgagttgtgacaaatcaacacaaaccccaagtc--
A0A2R9BZA9_BBC3-01      gtccgcgggga----ggaggaacagtg--ggcccgggagatcggggccca
A0A2R8Z688_BAD-01       ccccgcgggga----cggaggacgacgaagggatggggga--ggagccca
A0A2R8Z688_BAD-03       ccccgcgggga----cggaggacgacgaagggatggggga--ggagccca
                                                                       *  

A0A2R8ZXD2_BIK-01       gctttcatctacgaccagactgag-gacatcagggatgttcttagaagtt
A0A2R9AKC9_PMAIP1-      aactcttctgctcagga---------acctg-------------------
A0A2R9AKC9_PMAIP1-      aactcttctgctcagga---------acctg-------------------
A0A2R9BS98_BMF-01       gcctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaacc
A0A2R9BS98_BMF-02       gcctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaacc
A0A2R9C366_BCL2L11      ----ctccttgccag-----------gcctt-------------------
A0A2R9C366_BCL2L11      ----ctccttgccag-----------gcctt-------------------
A0A2R9BZA9_BBC3-01      gctgcggcg------gatggcggacgacctc---------------aacg
A0A2R8Z688_BAD-01       gcccctttc------ggggccgctcgcgctc---------------ggcg
A0A2R8Z688_BAD-03       gcccctttc------ggggccgctcgcgctc---------------ggcg
                                                     *                    

A0A2R8ZXD2_BIK-01       tcatggacggtttca-----------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       ccagcgactcttttatggcaatgctggctatcggcttcctctccctgcca
A0A2R9BS98_BMF-02       ccagcgactcttttatg---------------------------------
A0A2R9C366_BCL2L11      -caaccactatctca-----------------------------------
A0A2R9C366_BCL2L11      -caaccactatctca-----------------------------------
A0A2R9BZA9_BBC3-01      cgcagta-----cga-----------------------------------
A0A2R8Z688_BAD-01       ccccccaacctctgg-----------------------------------
A0A2R8Z688_BAD-03       ccccccaacctctgg-----------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       gtttcccagcagtcttgcccattggggagcagccccccgaagggcagtgg
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       caacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       --ccacacttaaggagaacataatgaggttctggagatccccgaacccca
A0A2R9AKC9_PMAIP1-      ---------------------------------actgcatcaaaaacttg
A0A2R9AKC9_PMAIP1-      ---------------------------------a----------------
A0A2R9BS98_BMF-01       ccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtg
A0A2R9BS98_BMF-02       ----------------------------caccagcagaaccaaaatcgtg
A0A2R9C366_BCL2L11      -------------------------------------------------g
A0A2R9C366_BCL2L11      -------------------------------------------------g
A0A2R9BZA9_BBC3-01      ------------gcggcggagacaagaggagcagcagcggcaccgcccct
A0A2R8Z688_BAD-01       ------------gcagc----------------acagcgctatggccgcg
A0A2R8Z688_BAD-03       ------------gcagc----------------acagcgctatggccgcg
                                                                          

A0A2R8ZXD2_BIK-01       ggtcctgggtgtcccgcgaacaggtgctgctggcgctgctgctgctgctg
A0A2R9AKC9_PMAIP1-      catgaggggactc-------------------------------cttcaa
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       tgtggtggcagat------------cctcct--c---------ttcctgc
A0A2R9BS98_BMF-02       tgtggtggcagat------------cctcct--c---------ttcctgc
A0A2R9C366_BCL2L11      tgcaatggctaac------------t------------------------
A0A2R9C366_BCL2L11      tgcaatggatgac------------tccgctgga---------tcctccc
A0A2R9BZA9_BBC3-01      cgccctggagggt------------cctgtacaa---------tctcatc
A0A2R8Z688_BAD-01       agctccggaggatgagtgacgagtttgtggactc---------ctttaag
A0A2R8Z688_BAD-03       agctccggaggatga-----------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       gcgctgctgctgccgctgctcagcgg------gggcctgcacctgctgc-
A0A2R9AKC9_PMAIP1-      aagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgc-
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       acaaccttgct----ttgaatggaga-----agagaacaggaacggggc-
A0A2R9BS98_BMF-02       acaaccttgct----ttgaatggaga-----agagaacaggaacggggc-
A0A2R9C366_BCL2L11      ----------------------ggga------------------------
A0A2R9C366_BCL2L11      tcagaattgcc----cttcatagggaagttcagtggccactcaagtggt-
A0A2R9BZA9_BBC3-01      atgggactcctgcccttacccaggggccacagagcccccgagatggagc-
A0A2R8Z688_BAD-01       aagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2R8Z688_BAD-03       --------------------------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2R8Z688_BAD-01       aagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgg
A0A2R8Z688_BAD-03       --------------------------------------------------
                                                                          

A0A2R8ZXD2_BIK-01       ---------------------tcaagtga
A0A2R9AKC9_PMAIP1-      ------------------attgtaattgg
A0A2R9AKC9_PMAIP1-      -----------------------------
A0A2R9BS98_BMF-01       --------aggcc--------ctaggtga
A0A2R9BS98_BMF-02       --------aggcc--------ctag----
A0A2R9C366_BCL2L11      ---------------------ctag----
A0A2R9C366_BCL2L11      --------tagcaaaatcaagctaa----
A0A2R9BZA9_BBC3-01      ---------------------ccaattag
A0A2R8Z688_BAD-01       gcaggggaagctccgccccctcccagtga
A0A2R8Z688_BAD-03       -----------------------------
                                                     

© 1998-2020Legal notice