Dataset for CDS classical BH3-containing proteins of organism Pan paniscus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A2R8Z688_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2R8Z688_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2R8ZXD2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan paniscus GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgagtctgaggaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccaggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2R9AKC9_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan paniscus GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcttcctcctcgccac
ttgcccttccccggggccacgaggaacaagcgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttg
catgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattgg
>gnl|bcl2dbcds|A0A2R9AKC9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan paniscus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2R9BS98_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pan paniscus GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2R9BS98_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Pan paniscus GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccaaaatcgtgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctag
>gnl|bcl2dbcds|A0A2R9BZA9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan paniscus GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgtgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2R9C366_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2R9C366_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
© 1998-2020Legal notice