Dataset for CDS BAD of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9HNZ2_BAD-01      atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggt
A0A3B3HDU2_BAD-01      atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggt
A0A3P9KSL7_BAD-01      atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggt
A0A3P9KSL7_BAD-02      atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggt

A0A3P9HNZ2_BAD-01      agagggaggaaaacttgacctgggagcggcaggaggaggaggaggaggag
A0A3B3HDU2_BAD-01      agagggaggaaaacttgacctgggagcggc---------agcaggaggag
A0A3P9KSL7_BAD-01      agagggaggaaaacttgacctgggagcggc---------agcaggaggag
A0A3P9KSL7_BAD-02      agagggaggaaaacttgacctgggagcggc---------agcaggaggag
                       ******************************         ** ********

A0A3P9HNZ2_BAD-01      aaggggagcaccttcatgatcgacattccctcaccctgccagagcttcga
A0A3B3HDU2_BAD-01      aaggggagcaccttcatgatcgacattccctcaccctgccagagcttcga
A0A3P9KSL7_BAD-01      aaggggagcaccttcatgatcgacattccctcacactgccagagcttcga
A0A3P9KSL7_BAD-02      aaggggagcaccttcatgatcgacattccctcacactgccagagcttcga
                       ********************************** ***************

A0A3P9HNZ2_BAD-01      ctcacaagtaacgggcgtaccaggctgaattcagagtccaccgcttccac
A0A3B3HDU2_BAD-01      ctcacaagtaacgggcgtaccaggctgaattcagagtccaccgcttccac
A0A3P9KSL7_BAD-01      ctcacaagtaacgggcgtaccaggctgaattcagagtccaccgcttccac
A0A3P9KSL7_BAD-02      ctcacaagtaacgggcgtaccaggctgaattcagagtccaccgcttccac

A0A3P9HNZ2_BAD-01      gtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccca
A0A3B3HDU2_BAD-01      gtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccca
A0A3P9KSL7_BAD-01      gtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccca
A0A3P9KSL7_BAD-02      gtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccca

A0A3P9HNZ2_BAD-01      ctgatgggttggccttcaggggcagatctaagtcggcccctccggccctg
A0A3B3HDU2_BAD-01      ctgatgggttggccttcaggggcagatccaagtcggcccctccggctctg
A0A3P9KSL7_BAD-01      ctgatgggttggccttcaggggcagatccaagtcggcccctccggccctg
A0A3P9KSL7_BAD-02      ctgatgggttggccttcaggggcagatccaagtcggcccctccggccctg
                       **************************** ***************** ***

A0A3P9HNZ2_BAD-01      tgggccgccaaaaagtacggccagcagctccgacggatgagcgacgagtt
A0A3B3HDU2_BAD-01      tgggccgccaaaaagtacggtcagcagctccgacggatgagcgacgagtt
A0A3P9KSL7_BAD-01      tgggccgccaaaaagtacggccagcagctccgacggatgagtgacgagtt
A0A3P9KSL7_BAD-02      tgggccgccaaaaagtacggccagcagctccgacggatgagtgacgagtt
                       ******************** ******************** ********

A0A3P9HNZ2_BAD-01      tgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg
A0A3B3HDU2_BAD-01      tgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg
A0A3P9KSL7_BAD-01      tgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg
A0A3P9KSL7_BAD-02      tgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg

A0A3P9HNZ2_BAD-01      cggccaaacagatgctccactccacgagctggtggaactacctcttcagc
A0A3B3HDU2_BAD-01      cggccaaacagatgctccactccacgagctggtggaactacctcttcagc
A0A3P9KSL7_BAD-01      cggccaaacagatgctccactccacgagctggtggaactacctcttcagc
A0A3P9KSL7_BAD-02      cggccaaacagatgctccactccacgagctggtggaactacctcttcagc

A0A3P9HNZ2_BAD-01      cacccggaggcagaaggagagtacagccaccacgagagccaacgcactga
A0A3B3HDU2_BAD-01      cacccggaggcggaaggagagtacagccaccacgagagccaccgcactga
A0A3P9KSL7_BAD-01      cacccggaggcggaaggagagtacagccaccacgagagccaccgcactga
A0A3P9KSL7_BAD-02      cacccggaggcggaaggagagtacagccaccacgagagccaccgcactga
                       *********** ***************************** ********

A0A3P9HNZ2_BAD-01      g-------------------------------------------------
A0A3B3HDU2_BAD-01      g-------------------------------------------------
A0A3P9KSL7_BAD-01      gaacagagaccttctggggtggttgcgttgttcttcggacattacggtca
A0A3P9KSL7_BAD-02      gaacagagaccttctggggtggttgcgttgttcttcggacattacggtca

A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      gccatgtcactgcaggctttcagcttccctttaccagaaactcgttattt
A0A3P9KSL7_BAD-02      gccatgtcactgcaggctttcagcttccctttaccagaaactcgttattt

A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      cagggctggtggtttgatctaccagttcaagatcagaggaggcagcaact
A0A3P9KSL7_BAD-02      cagggctggtggtttgatctaccagttcaagatcagaggaggcagcaact

A0A3P9HNZ2_BAD-01      ----------------------------------------taa
A0A3B3HDU2_BAD-01      ----------------------------------------taa
A0A3P9KSL7_BAD-01      tcaggcaagacagaactttctagaaccttcaattagaacttga
A0A3P9KSL7_BAD-02      tcagaga---------------------------------tga
                                                               * *

© 1998-2021Legal notice