Dataset for CDS BAD of organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3B3HDU2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=495 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggctctgtgggccgccaaaaagtacggtcagcagct
ccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagtaa
>gnl|bcl2dbcds|A0A3P9HNZ2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=504 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
aggaggaggaggaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagta
acgggcgtaccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggcc
ggaacccccactgatgggttggccttcaggggcagatctaagtcggcccctccggccctgtgggccgccaaaaagtacgg
ccagcagctccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg
cggccaaacagatgctccactccacgagctggtggaactacctcttcagccacccggaggcagaaggagagtacagccac
cacgagagccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3P9KSL7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=684 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcacactgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagcagct
ccgacggatgagtgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagaacagagaccttctggggtggttgcgttgttcttcggacattacggtcagccatgtcactgcaggctt
tcagcttccctttaccagaaactcgttatttcagggctggtggtttgatctaccagttcaagatcagaggaggcagcaac
ttcaggcaagacagaactttctagaaccttcaattagaacttga
>gnl|bcl2dbcds|A0A3P9KSL7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=651 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcacactgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagcagct
ccgacggatgagtgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagaacagagaccttctggggtggttgcgttgttcttcggacattacggtcagccatgtcactgcaggctt
tcagcttccctttaccagaaactcgttatttcagggctggtggtttgatctaccagttcaagatcagaggaggcagcaac
ttcagagatga
© 1998-2020Legal notice