Dataset for CDS BCL2L11 of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I8NCK5_BCL2L11      atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcgg
A0A6I8NCK5_BCL2L11      atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcgg
A0A6I8NCK5_BCL2L11      atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcgg
A0A6I8NCK5_BCL2L11      atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcgg
A0A6I8NCK5_BCL2L11      atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcgg
                        **************************************************

A0A6I8NCK5_BCL2L11      acgactggagcccgcagaggggccggctcagcccccgcagctccgacccg
A0A6I8NCK5_BCL2L11      acgactggagcccgcagaggggccggctcagcccccgcagctccgacccg
A0A6I8NCK5_BCL2L11      acgactggagcccgcagaggggccggctcagcccccgcagctccgacccg
A0A6I8NCK5_BCL2L11      acgactggagcccgcagaggggccggctcagcccccgcagctccgacccg
A0A6I8NCK5_BCL2L11      acgactggagcccgcagaggggccggctcagcccccgcagctccgacccg
                        **************************************************

A0A6I8NCK5_BCL2L11      gggcacctacctctatccgaacccagtatca-------------------
A0A6I8NCK5_BCL2L11      gggcacctacctctatccgaacccagtatca-------------------
A0A6I8NCK5_BCL2L11      gggcacctacctctatccgaacccagtatca-------------------
A0A6I8NCK5_BCL2L11      gggcacctacctctatccgaacccagtatcaaggtaatctctcgggcgga
A0A6I8NCK5_BCL2L11      gggcacctacctctatccgaacccagtatca-------------------
                        *******************************                   

A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      ggggaaagctgttcacagggcccgttcccgccgtccagtagccccaggcc
A0A6I8NCK5_BCL2L11      --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      gtttgccaccagatccccacttttcatctttgtccgaagatcgtcgctgc
A0A6I8NCK5_BCL2L11      --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      -------------------------------------agacaggagccct
A0A6I8NCK5_BCL2L11      -------------------------------------a------------
A0A6I8NCK5_BCL2L11      -------------------------------------agacaggagccct
A0A6I8NCK5_BCL2L11      tgtctagatcctccagcgggtatttctcttttgacacagacaggagccct
A0A6I8NCK5_BCL2L11      -------------------------------------agacaggagccct
                                                             *            

A0A6I8NCK5_BCL2L11      ccgcctgtgagttgcgataaatcgacccagacccccagtccccactgtca
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      ccgcctgtgagttgcgataaatcgacccagacccccagtccccactgtca
A0A6I8NCK5_BCL2L11      ccgcctgtgagttgcgataaatcgacccagacccccagtccccactgtca
A0A6I8NCK5_BCL2L11      ccgcctgtgagttgcgataaatcgacccagacccccagtccccactgtca
                                                                          

A0A6I8NCK5_BCL2L11      agccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
A0A6I8NCK5_BCL2L11      ----------------------------gcttccattagacagcctcagt
A0A6I8NCK5_BCL2L11      agccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
A0A6I8NCK5_BCL2L11      agccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
A0A6I8NCK5_BCL2L11      agccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
                                                    **********************

A0A6I8NCK5_BCL2L11      ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacgg
A0A6I8NCK5_BCL2L11      ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacgg
A0A6I8NCK5_BCL2L11      ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacgg
A0A6I8NCK5_BCL2L11      ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacgg
A0A6I8NCK5_BCL2L11      ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacgg
                        **************************************************

A0A6I8NCK5_BCL2L11      cgaattggagatgagtttaacgcttcctattgtccaagaag------ggg
A0A6I8NCK5_BCL2L11      cgaattggagatgagtttaacgcttcctattgtccaagaag------ggg
A0A6I8NCK5_BCL2L11      cgaattggagatgagtttaacgcttcctattgtccaagaag---------
A0A6I8NCK5_BCL2L11      cgaattggagatgagtttaacgcttcctattgtccaagaag---------
A0A6I8NCK5_BCL2L11      cgaattggagatgagtttaacgcttcctattgtccaagaaggacagggat
                        *****************************************         

A0A6I8NCK5_BCL2L11      tctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtg
A0A6I8NCK5_BCL2L11      tctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtg
A0A6I8NCK5_BCL2L11      ------------------------------------ggaaatgcttgatg
A0A6I8NCK5_BCL2L11      ------------------------------------------gtttgctg
A0A6I8NCK5_BCL2L11      gactggaggtcttgttttcatggggaggttgctgtcggatatgtttgctg
                                                                  * **  **

A0A6I8NCK5_BCL2L11      cacctgttacgttacatcctccgccgcgttggcgaactgcagtgactgtt
A0A6I8NCK5_BCL2L11      cacctgttacgttacatcctccgccgcgttggcgaactgcagtgactgtt
A0A6I8NCK5_BCL2L11      t------------------------------gagaccagaccta------
A0A6I8NCK5_BCL2L11      t------------------------------gcggccagaagtg------
A0A6I8NCK5_BCL2L11      t------------------------------gcggccagaagtg------
                                                       * *  * *   *       

A0A6I8NCK5_BCL2L11      tcttggagaagcgaaga--------cccccgggtgttcacctcatcctca
A0A6I8NCK5_BCL2L11      tcttggagaagcgaaga--------cccccgggtgttcacctcatcctca
A0A6I8NCK5_BCL2L11      -ctcggcttggggataaattctaccttgccaggcgacacgctg--cccca
A0A6I8NCK5_BCL2L11      -c-------ggagagga--------ttaccaag--------ta--ctccg
A0A6I8NCK5_BCL2L11      -c-------ggagagga--------ttaccaag--------ta--ctccg
                         *        * **  *           **  *        *   *  * 

A0A6I8NCK5_BCL2L11      gcggagcaaaccagagcggtggtagcttctccaatctacaactatgcaat
A0A6I8NCK5_BCL2L11      gcggagcaaaccagagcggtggtagcttctccaatctacaactatgcaat
A0A6I8NCK5_BCL2L11      tccggg---gccagatatgtag----------------------------
A0A6I8NCK5_BCL2L11      g-agag---aacagagagggagaaaaacttct-----------------t
A0A6I8NCK5_BCL2L11      g-agag---aacagagagggagaaaaacttct-----------------t
                           * *     ****   *  *                            

A0A6I8NCK5_BCL2L11      tgacactgttcctcatggataa
A0A6I8NCK5_BCL2L11      tgacactgttcctcatggataa
A0A6I8NCK5_BCL2L11      ----------------------
A0A6I8NCK5_BCL2L11      tggaact------------tga
A0A6I8NCK5_BCL2L11      tggaact------------tga
                                              

© 1998-2020Legal notice