Dataset for CDS BCL2L11 of organism Ornithorhynchus anatinus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=552 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggggtctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtgcacctgttacgt
tacatcctccgccgcgttggcgaactgcagtgactgtttcttggagaagcgaagacccccgggtgttcacctcatcctca
gcggagcaaaccagagcggtggtagcttctccaatctacaactatgcaattgacactgttcctcatggataa
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=462 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagcttccattagacagcctcagtctgttc
ctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttcctattgtcca
agaaggggtctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtgcacctgttacgttacatcctcc
gccgcgttggcgaactgcagtgactgtttcttggagaagcgaagacccccgggtgttcacctcatcctcagcggagcaaa
ccagagcggtggtagcttctccaatctacaactatgcaattgacactgttcctcatggataa
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=429 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaagggaaatgcttgatgtgagaccagacctactcggcttggggataaattctaccttgccaggcgaca
cgctgccccatccggggccagatatgtag
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=576 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaaggtaatctctcgggcggaggggaaagct
gttcacagggcccgttcccgccgtccagtagccccaggccgtttgccaccagatccccacttttcatctttgtccgaaga
tcgtcgctgctgtctagatcctccagcgggtatttctcttttgacacagacaggagccctccgcctgtgagttgcgataa
atcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttcctat
tgtccaagaaggtttgctgtgcggccagaagtgcggagaggattaccaagtactccggagagaacagagagggagaaaaa
cttctttggaacttga
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=471 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggacagggatgactggaggtcttgttttcatggggaggttgctgtcggatatgtttgctgtgcggc
cagaagtgcggagaggattaccaagtactccggagagaacagagagggagaaaaacttctttggaacttga
© 1998-2022Legal notice