Dataset for CDS classical BH3-containing proteins of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HX97_PMAIP1-      -agcctgggagaagcgcgcaggaacgctc---------------------
A0A2I3HX97_PMAIP1-      aagcctgggag-agcgcgcaggaacgctc---------------------
G1S1X2_BIK-01           ----atg---tccgaagtaagacccatctccagagacatcttgatggaga
A0A2I3H4B2_BAD-01       ----atgggggaggagcccagcccttttc------------------gcg
G1QHD8_HRK-01           ----atg-----------------tgccc------------------gtg
A0A2I3HWI8_BBC3-01      ----atgaaatttggcatggggtctgccc------------------ggg
A0A2I3HWI8_BBC3-02      ----atgaaatttggcatggggtctgccc------------------ggg
A0A2I3HWI8_BBC3-03      ----atgaaatttggcatggggtctgccc------------------ggg
A0A2I3HD83_BMF-01       ----atg----------g---agccatc----------------------
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
A0A2I3GAA1_BCL2L11      ----atg----------gcaaagcaacct------------------tct
                             **                                           

A0A2I3HX97_PMAIP1-      --------aaccgagccccgcgccggctccagcaggtaccgacccgctgg
A0A2I3HX97_PMAIP1-      --------aaccgagccccgcgccggctccagcaga---------gctg-
G1S1X2_BIK-01           gcctcctgtatgagcagctcctggaacccccgaccatggaggttcttggc
A0A2I3H4B2_BAD-01       gccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggc
G1QHD8_HRK-01           c---cccctgcaccgcg-gccgcggccccccggccgtgtgcgcctgcagc
A0A2I3HWI8_BBC3-01      catgtccatgccaggtg-cccagggcttct------------tccgtgac
A0A2I3HWI8_BBC3-02      catgtccatgccaggtg-cccagggcttct------------tccgtgac
A0A2I3HWI8_BBC3-03      catgtccatgccaggtg-cccagggcttct------------tccgtgac
A0A2I3HD83_BMF-01       ---------tcagtgtgtg---gaggagctagaggatgatgtgttccaac
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
A0A2I3GAA1_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaa-------ttgcagc
                                                                          

A0A2I3HX97_PMAIP1-      gga-----cggcggggacggcgaggaaccaagccggatttgggattggga
A0A2I3HX97_PMAIP1-      ----------------------------------gaagttgagtgtgcta
G1S1X2_BIK-01           gtgactgaccctgaagaggacctggaccctatggaggacttcgatccttt
A0A2I3H4B2_BAD-01       cgc---------------------------------------gagctccg
G1QHD8_HRK-01           gcg---------------------------------------ggtcgcct
A0A2I3HWI8_BBC3-01      gtg---------------------------------------ggtcccct
A0A2I3HWI8_BBC3-02      gtg---------------------------------------ggtcccct
A0A2I3HWI8_BBC3-03      gtg---------------------------------------ggtcccct
A0A2I3HD83_BMF-01       cag-----aggatggggagccgggcacccaacccggga--gcttgctctc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
A0A2I3GAA1_BCL2L11      ctg-----cggagaggcctccccagctcagacctggggcccctacctccc
                                                                          

A0A2I3HX97_PMAIP1-      tgcagctgcgtttcaccaggggcaaa------------------------
A0A2I3HX97_PMAIP1-      ctcaact---------caggag----------------------------
G1S1X2_BIK-01           gcagtgcatggagggcagtgacgcgc------------------------
A0A2I3H4B2_BAD-01       g-------------------------------------------------
G1QHD8_HRK-01           g-------------------------------------------------
A0A2I3HWI8_BBC3-01      gccagatttgt---------------------------------------
A0A2I3HWI8_BBC3-02      gccagatttgtggccccagggagcgccatggcccgcgcacgccaggaggg
A0A2I3HWI8_BBC3-03      gccagatttgt---------------------------------------
A0A2I3HD83_BMF-01       tgctgacctgtttgcccagagcctac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
A0A2I3GAA1_BCL2L11      tacaga----------cagagcc-ac------------------------
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccct
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      tcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgag
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cccggcctagctgccgcccccgccgcccccgccctgctgcccgctgccta
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cctctgcgcccccaccgctccacccgccgtcaccgccgccctggggggcc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cccgctggcccgggggtcctcgcagccggccccgaggcccgcgcccggac
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      -------------------aagctcctctcctcctct-------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           -------------------tggccccgcggctggcctgcatcggggacga
A0A2I3H4B2_BAD-01       -------------------aggatgagtgacgagtttg---tgg------
G1QHD8_HRK-01           -------------------gggctgcg---ctcgtccg---ccg------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      gcaggcggtcccacccaggcggctccg---ggagtccg---cggggagga
A0A2I3HWI8_BBC3-03      gcaggcggtcccacccaggcggctccg---ggagtccg---cggggagga
A0A2I3HD83_BMF-01       -------------------tgg----------------------------
A0A2I3GAA1_BCL2L11      -------------------aag----------------------------
A0A2I3GAA1_BCL2L11      -------------------aag----------------------------
A0A2I3GAA1_BCL2L11      -------------------aagct--tccatgaggca-------------
A0A2I3GAA1_BCL2L11      -------------------aaggtaatcctgaaggcaatcacggaggtga
A0A2I3GAA1_BCL2L11      -------------------aaggtaatcctgaaggcaatcacggaggtga
A0A2I3GAA1_BCL2L11      -------------------aaggtaatcctgaaggcaatcacggaggtga
A0A2I3GAA1_BCL2L11      -------------------aaggtaatcctgaaggcaatcacggaggtga
A0A2I3GAA1_BCL2L11      -------------------aaggtaatcctgaaggcaatcacggaggtga
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------ctttcctcctcgccactt
A0A2I3HX97_PMAIP1-      ----------------------------------------------attt
G1S1X2_BIK-01           gatggacgtgagcctcagggccccgcgcctggcccagctctccgaggtgg
A0A2I3H4B2_BAD-01       -----------------------------------------------act
G1QHD8_HRK-01           --------------------------------cgcagctcaccgccgccc
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacg
A0A2I3HWI8_BBC3-03      ggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacg
A0A2I3HD83_BMF-01       --------actgccccctcagccgacttcagctcttccctctcacccact
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      aggggacagctgcccccacggcagccctcag---ggcccgctggccccac
A0A2I3GAA1_BCL2L11      aggggacagctgcccccacggcagccctcag---ggcccgctggccccac
A0A2I3GAA1_BCL2L11      aggggacagctgcccccacggcagccctcag---ggcccgctggccccac
A0A2I3GAA1_BCL2L11      aggggacagctgcccccacggcagccctcag---ggcccgctggccccac
A0A2I3GAA1_BCL2L11      aggggacagctgcccccacggcagccctcag---ggcccgctggccccac
                                                                          

A0A2I3HX97_PMAIP1-      gcccttccccggggccacgaggaacaagtgcaagt---------------
A0A2I3HX97_PMAIP1-      g-------------------------------------------------
G1S1X2_BIK-01           ccatgc--------------------------------------------
A0A2I3H4B2_BAD-01       ccttta--------------------------------------------
G1QHD8_HRK-01           ggctca--------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      acctca--------------------------------------------
A0A2I3HWI8_BBC3-03      acctca--------------------------------------------
A0A2I3HD83_BMF-01       gctgtggccctggccttc--------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      -ggctgaacctg-------------cagat--------------------
A0A2I3GAA1_BCL2L11      cggccagccctggcccttttgctaccagatccccgcttttcatctttatg
A0A2I3GAA1_BCL2L11      cggccagccctggcccttttgctaccagatccccgcttttcatctttatg
A0A2I3GAA1_BCL2L11      cggccagccctggcccttttgctaccagatccccgcttttcatctttatg
A0A2I3GAA1_BCL2L11      cggccagccctggcccttttgctaccagatccccgcttttcatctttatg
A0A2I3GAA1_BCL2L11      cggccagccctggcccttttgctaccagatccccgcttttcatctttatg
                                                                          

A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      -----atgcgcccggagatatggattgcccaagagttgcggcgtatcgga
A0A2I3GAA1_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A2I3GAA1_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A2I3GAA1_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A2I3GAA1_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A2I3GAA1_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
                                                                          

A0A2I3HX97_PMAIP1-      -----gagaacgtcattatcgcggcagaagggaca----aactgaacttc
A0A2I3HX97_PMAIP1-      -----------------------------gagaca----aactgaacttc
G1S1X2_BIK-01           -----acagcctgggtctggctttcatctatgaccagactgaggacat--
A0A2I3H4B2_BAD-01       -----agggacttcctcgcccgaagagcgcgggca----cagcaacgcag
G1QHD8_HRK-01           -----aggcgct-----aggcgacgagctgcacca----gcgcaccat-g
A0A2I3HWI8_BBC3-01      -----------------------------gagacaagaggagcaaca---
A0A2I3HWI8_BBC3-02      -----acgcgca-----gtacgagcggcggagacaagaggagcaaca---
A0A2I3HWI8_BBC3-03      -----acgcgca-----gtacgagcggcggagacaagaggagcaaca---
A0A2I3HD83_BMF-01       ----------gacccaccagccaggaa----gaca----aagctacccag
A0A2I3GAA1_BCL2L11      -----acaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      -----acaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      gac------gagtttaacgcttacta--tgcaagg----aggctggcaaa
A0A2I3GAA1_BCL2L11      cacagacaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      cacagacaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      cacagacaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      cacagacaggagcccagcacccatgagttgtgaca----aatcaacacaa
A0A2I3GAA1_BCL2L11      cacagacaggagcccagcacccatgagttgtgaca----aatcaacacaa
                                                                          

A0A2I3HX97_PMAIP1-      cggcagaaacttctgaatc-------------------------------
A0A2I3HX97_PMAIP1-      cggcagaaacttctgaatc-------------------------------
G1S1X2_BIK-01           ---cagggatgttcttagaagtttcatggacggtttcaccacctttaagg
A0A2I3H4B2_BAD-01       atgcggcaaagctcc---a-----gctggacg------------------
G1QHD8_HRK-01           tggcggcgccgcgcgcgga-----gccggagggcgccggcgcccggcgcg
A0A2I3HWI8_BBC3-01      --gcggcaccgcccctcgc-----cctggagg--------gtcctgtaca
A0A2I3HWI8_BBC3-02      --gcggcaccgcccctcgc-----cctggagg--------gtcctgtaca
A0A2I3HWI8_BBC3-03      --gcggcaccgcccctcgc-----cctggagg--------gtcctgtaca
A0A2I3HD83_BMF-01       accctcagcccagcctccc----ccagccaaggtgtcatgctgccttgtg
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      actcctgg------------------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
A0A2I3GAA1_BCL2L11      accccaagtcctccttgcc-------------------------------
                           *                                              

A0A2I3HX97_PMAIP1-      -tgatatccaaactcttctg-----------ctcaggaacctgactgcat
A0A2I3HX97_PMAIP1-      -tgatatccaaactcttctg-----------ctcaggaacctga------
G1S1X2_BIK-01           agaacataataaggctctggagatccccgaaccccgggtcccgggtgtcc
A0A2I3H4B2_BAD-01       ---------cgagtcttcca----gtcct---------------------
G1QHD8_HRK-01           ctccccac------ctactg----gccctggctgtgcgcggccgcgc---
A0A2I3HWI8_BBC3-01      atctcatcatgggactcctg----cccttacccaggggccacagagcccc
A0A2I3HWI8_BBC3-02      atctcatcatgggactcctg----cccttacccaggggccacagagcccc
A0A2I3HWI8_BBC3-03      atctcatcatgggactcctg----cccttacccaggggccacagagcccc
A0A2I3HD83_BMF-01       gggtgactgaggaaccccag----cgactctttta-tgcaccagcagaac
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaatggtagtca
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaatggatgagg
A0A2I3GAA1_BCL2L11      -----------------cat----cctccacctga---------------
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaatggtt----
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaat--------
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaatggcttcca
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaatggcttcca
A0A2I3GAA1_BCL2L11      ----------aggccttcaa----ccactatctcagtgcaat--------
                                                                          

A0A2I3HX97_PMAIP1-      caaaaacttgcatgaggggactccttcaaaag------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           cgcgaacagatgctgctggtgctgctgg----------------------
A0A2I3H4B2_BAD-01       ---ggtgggatc------gga--acttg----------------------
G1QHD8_HRK-01           --aggtggcggc--gctggcg--gcctg----------------------
A0A2I3HWI8_BBC3-01      cgagatggagcccaattaggt--gcctgcacccgcccggtggacgtcagg
A0A2I3HWI8_BBC3-02      cgagatggagcccaattaggt--gcctgcacccgcccggtggacgtcagg
A0A2I3HWI8_BBC3-03      cgagatggagcccaattag-------------------------------
A0A2I3HD83_BMF-01       cgaaatcgcgtgtggtggcagatcctcctcttcctgcaca----------
A0A2I3GAA1_BCL2L11      tcctagaggatgtaggtgatatttcactgtggtttggatttatatttact
A0A2I3GAA1_BCL2L11      ccgctggatcctccctcgaagttcagtggccattcgagtggtt-------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      -------------------------------agagaaataga--------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3GAA1_BCL2L11      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3GAA1_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      ----------------------------------------------agtt
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           -------------tgctgctgctgctgctgctg-------------ccgc
A0A2I3H4B2_BAD-01       --------------------------------------------------
G1QHD8_HRK-01           ------------------------------------------------gc
A0A2I3HWI8_BBC3-01      gactcggggggcaggcccctcccacctcctgac-------------accc
A0A2I3HWI8_BBC3-02      gactcggggggcaggcccctcccacctcctgac-------------accc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       ----------------------------------------------acct
A0A2I3GAA1_BCL2L11      g---------------------------------------------gctt
A0A2I3GAA1_BCL2L11      ----------------------------------------------agca
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      ----------------------------------------------ggaa
A0A2I3GAA1_BCL2L11      ----------------------------------------------ggct
A0A2I3GAA1_BCL2L11      gagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggtt
A0A2I3GAA1_BCL2L11      gagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
A0A2I3GAA1_BCL2L11      ----------------------------------------------gggt
                                                                          

A0A2I3HX97_PMAIP1-      ttctcaggaggcgcacatttcatcaatttgaagaaagattgcattgtaat
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           tgctcagcggggg---cctgtacctgctgaattga---------------
A0A2I3H4B2_BAD-01       -----ggcaggggaagctccgccccctcccagtga---------------
G1QHD8_HRK-01           tgctcggcaggcggaact------------tgtag---------------
A0A2I3HWI8_BBC3-01      tggccagcgtggggaactttctctgcaccatgtag---------------
A0A2I3HWI8_BBC3-02      tggccagcgtggggaactttctctgcaccatgtag---------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2I3HD83_BMF-01       tgctttgaatggagaagagaacaggaatggggcaggccctag--------
A0A2I3GAA1_BCL2L11      agatttgtatggccaccaccatagtcaagatacagaacaattcaaccaca
A0A2I3GAA1_BCL2L11      aaatcaagctaa--------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      gttgtcgtgtag--------------------------------------
A0A2I3GAA1_BCL2L11      aactgggactag--------------------------------------
A0A2I3GAA1_BCL2L11      a-----gagaaatag-----------------------------------
A0A2I3GAA1_BCL2L11      atttttgaataattaccaagcagccgaagaccacccacgaatggttatct
A0A2I3GAA1_BCL2L11      atttttgaataa--------------------------------------
                                                                          

A0A2I3HX97_PMAIP1-      -----------------------------------------------
A0A2I3HX97_PMAIP1-      -----------------------------------------------
G1S1X2_BIK-01           -----------------------------------------------
A0A2I3H4B2_BAD-01       -----------------------------------------------
G1QHD8_HRK-01           -----------------------------------------------
A0A2I3HWI8_BBC3-01      -----------------------------------------------
A0A2I3HWI8_BBC3-02      -----------------------------------------------
A0A2I3HWI8_BBC3-03      -----------------------------------------------
A0A2I3HD83_BMF-01       -----------------------------------------------
A0A2I3GAA1_BCL2L11      aggatttctcatga---------------------------------
A0A2I3GAA1_BCL2L11      -----------------------------------------------
A0A2I3GAA1_BCL2L11      -----------------------------------------------
A0A2I3GAA1_BCL2L11      -----------------------------------------------
A0A2I3GAA1_BCL2L11      -----------------------------------------------
A0A2I3GAA1_BCL2L11      -----------------------------------------------
A0A2I3GAA1_BCL2L11      tacgactgttacgttacattgtccgcctggtgtggagaatgcattga
A0A2I3GAA1_BCL2L11      -----------------------------------------------
                                                                       

© 1998-2022Legal notice