Dataset for CDS classical BH3-containing proteins of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1QHD8_HRK-01           atgt----------------------------------------------
A0A2I3HX97_PMAIP1-      aag-----------------------------------------------
G1S1X2_BIK-01           atgtccgaagtaagacccatctccagagacatcttgatggagagcctcct
A0A2I3HD83_BMF-01       atgg----------agccatc-----------------------------
A0A2I3GVB2_BCL2L11      atggc-------aaagcaaccttctg------------------------
A0A2I3GVB2_BCL2L11      atggc-------aaagcaaccttctg------------------------
A0A2I3H4B2_BAD-01       atg-----------------------------------------------
A0A2I3HWI8_BBC3-03      atga----------------------------------------------
                        * *                                               

G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HX97_PMAIP1-      ------------------------------------cctggg--------
G1S1X2_BIK-01           gtatgagcagctcctggaacccccgaccatggaggttcttggcgtgactg
A0A2I3HD83_BMF-01       ------------------------------------tcagtgtgtg---g
A0A2I3GVB2_BCL2L11      ----------------------------atgtaagttctgagtgtgaccg
A0A2I3GVB2_BCL2L11      ----------------------------atgtaagttctgagtgtgaccg
A0A2I3H4B2_BAD-01       --------------------------------------gggg--------
A0A2I3HWI8_BBC3-03      ----------------------------aatttggcatggggtctgcccg
                                                                          

G1QHD8_HRK-01           -------------------gcccgtgccccctgcaccgcggccgcggccc
A0A2I3HX97_PMAIP1-      --------------ag----------------------------------
G1S1X2_BIK-01           accctga-------agaggacctggaccctatggaggacttcgatccttt
A0A2I3HD83_BMF-01       a----gg-------ag--------------ctagagga---tgatgtgtt
A0A2I3GVB2_BCL2L11      a----ga-------ag--------------gtagacaa----------tt
A0A2I3GVB2_BCL2L11      a----ga-------ag--------------gtagacaa----------tt
A0A2I3H4B2_BAD-01       --------------aggagcccagccctttt-------------------
A0A2I3HWI8_BBC3-03      ggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccct
                                                                          

G1QHD8_HRK-01           cccggccgtgtgcgc-----------------------------------
A0A2I3HX97_PMAIP1-      ------agcgcgcag-----------------------------------
G1S1X2_BIK-01           gcagtgcatggagggcagtgacgcgctggccccgcggctggcctgcatcg
A0A2I3HD83_BMF-01       ccaaccagaggatgg-----------------------------------
A0A2I3GVB2_BCL2L11      gcagcctgcggagag-----------------------------------
A0A2I3GVB2_BCL2L11      gcagcctgcggagag-----------------------------------
A0A2I3H4B2_BAD-01       ----------cgcgg-----------------------------------
A0A2I3HWI8_BBC3-03      gccagatttgtgcag-----------------------------------
                                                                          

G1QHD8_HRK-01           -------------------ctgcagcgcgggtcgcctggggctgcgctc-
A0A2I3HX97_PMAIP1-      ------------------------gaacgctcaacc--gagccccgcgcc
G1S1X2_BIK-01           gggacgagatggacgtgagcctcagggccccgcgcctgg----cccagct
A0A2I3HD83_BMF-01       ------------------ggagccgggcacccaacccggga--gcttgct
A0A2I3GVB2_BCL2L11      ------------------gcctccccagctcagacctggggcccctacct
A0A2I3GVB2_BCL2L11      ------------------gcctccccagctcagacctggggcccctacct
A0A2I3H4B2_BAD-01       ------------------------ccgctcgcgctc-ggcgccccccaa-
A0A2I3HWI8_BBC3-03      ------------------------gcggtcccacccaggcggctccggga
                                                           *  *     *     

G1QHD8_HRK-01           gtccgccg-----------cgcagct------------------------
A0A2I3HX97_PMAIP1-      ggctccag-----------cagagct------------------------
G1S1X2_BIK-01           ctcc---gaggtggccatgcacagcc------------------------
A0A2I3HD83_BMF-01       ctctgctgacctgtttgcccagagcc------------------------
A0A2I3GVB2_BCL2L11      ccctacaga----------cagagccacaaggtaatcctgaaggcaatca
A0A2I3GVB2_BCL2L11      ccctacaga----------cagagccaca---------------------
A0A2I3H4B2_BAD-01       --cctctgggcag------cacagcg------------------------
A0A2I3HWI8_BBC3-03      gtccgcggggagg------aggaaca------------------------
                          *    *              * *                         

G1QHD8_HRK-01           --------------------------------------------------
A0A2I3HX97_PMAIP1-      -------------------------------------ggaagttgagtgt
G1S1X2_BIK-01           -------------------------------------tgggtctggcttt
A0A2I3HD83_BMF-01       ----------------------------------------tactggactg
A0A2I3GVB2_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccctcagggcccgctgg
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2I3H4B2_BAD-01       ------------------------------------ctatggccgcgagc
A0A2I3HWI8_BBC3-03      ------------------------------------gtgggcccgggaga
                                                                          

G1QHD8_HRK-01           caccgccgcccggctcaaggcgctag------------------------
A0A2I3HX97_PMAIP1-      gc----tactcaactcaggagatttg------------------------
G1S1X2_BIK-01           catctatgaccagactgaggacatca------------------------
A0A2I3HD83_BMF-01       ccccctcagccgacttcagctcttcc------------------------
A0A2I3GVB2_BCL2L11      ccccaccggccagccctggcccttttgctaccagatccccgcttttcatc
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2I3H4B2_BAD-01       tccggaggatgagtgacg--agtttg------------------------
A0A2I3HWI8_BBC3-03      tc--ggggcccagctgcggcggatgg------------------------
                                                                          

G1QHD8_HRK-01           -----gcgacgagct-----------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           -----gggatgttcttagaagtttcatggacggt----------------
A0A2I3HD83_BMF-01       -----------ctctcacccactgctgtggccct----------------
A0A2I3GVB2_BCL2L11      tttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2I3H4B2_BAD-01       -----tggactcctttaagggacttcctcgcccg----------------
A0A2I3HWI8_BBC3-03      -----cggacgacctcaacg-----cgcagtacg----------------
                                                                          

G1QHD8_HRK-01           -----------gcaccagcgcaccat------gtggcggcgccgcg----
A0A2I3HX97_PMAIP1-      ----------gagacaaactgaacttccggcagaaac-------------
G1S1X2_BIK-01           ------------------ttcaccacctttaaggag-aacataataaggc
A0A2I3HD83_BMF-01       ---------ggccttcgacccaccagccaggaa----gacaaagcta---
A0A2I3GVB2_BCL2L11      ttttgacacagacaggagcccagcacccatgagttgtgacaaatcaa---
A0A2I3GVB2_BCL2L11      ---------agacaggagcccagcacccatgagttgtgacaaatcaa---
A0A2I3H4B2_BAD-01       -------aagagcgcgggcacagcaac--gcagatgcggcaaagc-----
A0A2I3HWI8_BBC3-03      -------agcggcggagaca-agagga--gcaacagcggcaccgc-----
                                             *                            

G1QHD8_HRK-01           ----------cgcggagccggagggcgccggcgcccggcgcgctccccac
A0A2I3HX97_PMAIP1-      ----------ttctgaatctgat----------atccaaactcttctgct
G1S1X2_BIK-01           tctggagatccccgaaccccggg-----------tcccgggtgtccc-gc
A0A2I3HD83_BMF-01       ----------cccagaccctcag-----------cccagcctcccccagc
A0A2I3GVB2_BCL2L11      ----------cacaaaccccaag-----------tc------ctccttgc
A0A2I3GVB2_BCL2L11      ----------cacaaaccccaag-----------tc------ctccttgc
A0A2I3H4B2_BAD-01       ----------tcc---agctggacgcg--agtcttcca----gtcctggt
A0A2I3HWI8_BBC3-03      ----------ccctcgccctgga---g--ggtcctgtacaatctcatcat
                                    *     *                               

G1QHD8_HRK-01           cta-----------------------------------ctggccctggct
A0A2I3HX97_PMAIP1-      cag-----------------------------------------------
G1S1X2_BIK-01           gaa------------------------------------cagatgctgct
A0A2I3HD83_BMF-01       caaggtgtcatgctgccttgtggggtgactgaggaaccccagcgactctt
A0A2I3GVB2_BCL2L11      cag-----------gcctt--------------------caaccactatc
A0A2I3GVB2_BCL2L11      cag-----------gcctt--------------------caaccactatc
A0A2I3H4B2_BAD-01       ggg--------------------------------a--tcggaactt---
A0A2I3HWI8_BBC3-03      ggg--------------------------------actcctgccctt---
                                                                          

G1QHD8_HRK-01           gtgcgcggcc----------------gcgcaggtggcggcgctggcgg--
A0A2I3HX97_PMAIP1-      --------------------------------------------------
G1S1X2_BIK-01           g-------------------------gtgctgctggtgctgctgctgctg
A0A2I3HD83_BMF-01       ttatgcaccagcagaaccgaaatcgcgtgtggtggcagatcctcct----
A0A2I3GVB2_BCL2L11      tca-----------------------gtgcaatggctaa-----ctgg--
A0A2I3GVB2_BCL2L11      tca-----------------------gtgcaatggatgaggccgctggat
A0A2I3H4B2_BAD-01       --------------------------gggcaggggaagctccgccc----
A0A2I3HWI8_BBC3-03      --------------------------acccaggggccacagagccc----
                                                                          

G1QHD8_HRK-01           ----cctggctgctcggc--------------------------aggcgg
A0A2I3HX97_PMAIP1-      -------------------------------------------------g
G1S1X2_BIK-01           ctgctgccgctgctcagcgg-----------------------gggcctg
A0A2I3HD83_BMF-01       cttcctgcacaaccttgctttgaatggagaagagaacaggaatggggcag
A0A2I3GVB2_BCL2L11      --------------------------------------------ga----
A0A2I3GVB2_BCL2L11      cctccctcgaagttcagtggccattcgagtggttagcaaaatcaag----
A0A2I3H4B2_BAD-01       -----------------------------------------cc-------
A0A2I3HWI8_BBC3-03      -----------------------------------------ccgagatgg
                                                                          

G1QHD8_HRK-01           aacttgtag------
A0A2I3HX97_PMAIP1-      aacctga--------
G1S1X2_BIK-01           tacctgctgaattga
A0A2I3HD83_BMF-01       gccctag--------
A0A2I3GVB2_BCL2L11      ---ctag--------
A0A2I3GVB2_BCL2L11      ---ctaa--------
A0A2I3H4B2_BAD-01       -tcccagtga-----
A0A2I3HWI8_BBC3-03      agcccaattag----
                                       

© 1998-2020Legal notice