Dataset for CDS classical BH3-containing proteins of organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=279 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccgctggatcctccctcgaa
gttcagtggccattcgagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2I3H4B2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Nomascus leucogenys GN=BAD (length=249 residues).
atgggggaggagcccagcccttttcgcggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcaacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccc
tcccagtga
>gnl|bcl2dbcds|A0A2I3HD83_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Nomascus leucogenys GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctagaggatgatgtgttccaaccagaggatggggagccgggcacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaatggggcaggccctag
>gnl|bcl2dbcds|A0A2I3HWI8_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Nomascus leucogenys GN=BBC3 (length=324 residues).
atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccctgcca
gatttgtgcaggcggtcccacccaggcggctccgggagtccgcggggaggaggaacagtgggcccgggagatcggggccc
agctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcaacagcggcaccgcccctcg
ccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaa
ttag
>gnl|bcl2dbcds|A0A2I3HX97_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Nomascus leucogenys GN=PMAIP1 (length=162 residues).
aagcctgggagagcgcgcaggaacgctcaaccgagccccgcgccggctccagcagagctggaagttgagtgtgctactca
actcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacct
ga
>gnl|bcl2dbcds|G1QHD8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Nomascus leucogenys GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G1S1X2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Nomascus leucogenys GN=BIK (length=480 residues).
atgtccgaagtaagacccatctccagagacatcttgatggagagcctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttgcagtgcatggagggca
gtgacgcgctggccccgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctatgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacctttaaggagaacataataaggctctggagatccccgaaccccgggtcccgggtgtcccgcg
aacagatgctgctggtgctgctggtgctgctgctgctgctgctgccgctgctcagcgggggcctgtacctgctgaattga
© 1998-2020Legal notice