Dataset for CDS classical BH3-containing proteins of organism Neovison vison

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U6CSY8_BMF-01          atgg---agccgcc-------------tcagtgtgtggaggagctggagg
U6CTE3_BCL2L11-04      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-01      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-02      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-03      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
                       ****   ***  **             ** * *****   ***  ** **

U6CSY8_BMF-01          atgatgtgttccagccagaggatggggagccggggacccagcctggga--
U6CTE3_BCL2L11-04      acaa----ttgcagcctgttgagaggcctcctcagctcaggcctggggcc
U6CTE3_BCL2L11-01      acaa----ttgcagcctgttgagaggcctcctcagctcaggcctggggcc
U6CTE3_BCL2L11-02      acaa----ttgcagcctgttgagaggcctcctcagctcaggcctggggcc
U6CTE3_BCL2L11-03      acaa----ttgcagcctgttgagaggcctcctcagctcaggcctggggcc
                       *  *    ** ***** *  **  **   **   *  *  *******   

U6CSY8_BMF-01          gcttgctctctgctgacctgtttgcccagagccagctggactgcccgctt
U6CTE3_BCL2L11-04      cctacctctctacaga----------cagag-cagcaa------------
U6CTE3_BCL2L11-01      cctacctctctacaga----------cagag-cagcaaggtaatcctgaa
U6CTE3_BCL2L11-02      cctacctctctacaga----------cagag-cagcaaggtaatcctgaa
U6CTE3_BCL2L11-03      cctacctctctacaga----------cagag-cagca-------------
                        **  ****** * **          ***** ****              

U6CSY8_BMF-01          agccgtctgcatctcttccctctcacccactgctgtggccctgggcttcg
U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      ggcgaaggggaccgctgcccccaaggcagccctcagggcccactggcccc
U6CTE3_BCL2L11-02      ggcgaaggggaccgctgcccccaaggcagccctcagggcccactggcccc
U6CTE3_BCL2L11-03      --------------------------------------------------

U6CSY8_BMF-01          acccaccagccaggaggacaaggccacccagaccctcagtccggcctccc
U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      acctgccagccccggcccttttgctaccagatccccgcttttcatctttg
U6CTE3_BCL2L11-02      acctgccagccccggcccttttgctaccagatccccgcttttcatctttg
U6CTE3_BCL2L11-03      --------------------------------------------------

U6CSY8_BMF-01          cgagtcagggtgtcatgctgccttg-------------------------
U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
U6CTE3_BCL2L11-02      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
U6CTE3_BCL2L11-03      --------------------------------------------------

U6CSY8_BMF-01          tggggtgaccgaagaac----cccagcgactcttttatggcaacgctggc
U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      gacacagacaggagcccggcacccatgagttgtgacaaatcaacacaaac
U6CTE3_BCL2L11-02      gacacagacaggagcccggcacccatgagttgtgacaaatcaacacaaac
U6CTE3_BCL2L11-03      -----agacaggagcccggcacccatgagttgtgacaaatcaacacaaac

U6CSY8_BMF-01          taccggctccctctccctg--------ccagcttccctgcaggcttgccc
U6CTE3_BCL2L11-04      ----------------------------------------------gctt
U6CTE3_BCL2L11-01      cccaagtcctccttgccaggccttcaaccattatctcagtgcaatggctt
U6CTE3_BCL2L11-02      cccaagtcctccttgccaggccttcaaccattatctcagtgcaatggctt
U6CTE3_BCL2L11-03      cccaagtcctccttgccaggccttcaaccattatctcagtgcaatggctt

U6CSY8_BMF-01          ctcggggaccagccccctgaagggcagtggcagca-----tcgagcagag
U6CTE3_BCL2L11-04      ccaggagg-cagtctc-----aggctgtacctgcagatatgcgcccggag
U6CTE3_BCL2L11-01      ccaggagg-cagtctc-----aggctgtacctgcagatatgcgcccggag
U6CTE3_BCL2L11-02      ccaggagg-cagtctc-----aggctgtacctgcagatatgcgcccggag
U6CTE3_BCL2L11-03      ccaggagg-cagtctc-----aggctgtacctgcagatatgcgcccggag
                       *  ** *  *** * *      *** **  * ***      **  * ***

U6CSY8_BMF-01          gtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgact
U6CTE3_BCL2L11-04      atgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcata
U6CTE3_BCL2L11-01      atgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcata
U6CTE3_BCL2L11-02      atgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcata
U6CTE3_BCL2L11-03      atgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcata
                        *   ****** *   ** * * * * **** **** ****  **  *  

U6CSY8_BMF-01          tcacatgcagcaacaccagcaaaaccaaaatcgggtgtggtggcagatcc
U6CTE3_BCL2L11-04      ttac--------------------ccaag---gaggct------------
U6CTE3_BCL2L11-01      ttac--------------------ccaag---gagggtctttttgaataa
U6CTE3_BCL2L11-02      ttac--------------------ccaag---gaggtt------------
U6CTE3_BCL2L11-03      ttac--------------------ccaag---gaggtt------------
                       * **                    ****    * *  *            

U6CSY8_BMF-01          ttctcttcctacacaaccttgctttga-----------------------
U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      ttacccagcagcagaagcccacccccaaatgattatcttacgactgttac
U6CTE3_BCL2L11-02      --------------------------------------------------
U6CTE3_BCL2L11-03      --------------------------------------------------

U6CSY8_BMF-01          --------acgcagatgggaacaggaatggggcgggtcccaggtga
U6CTE3_BCL2L11-04      ------------------ggcaagaattccagcatcctgcctctgc
U6CTE3_BCL2L11-01      gttacatcatccgcctggtgtggagattgcagtga-----------
U6CTE3_BCL2L11-02      -----------------------aga--gcaatag-----------
U6CTE3_BCL2L11-03      -----------------------aga--gcaatag-----------

© 1998-2022Legal notice