Dataset for CDS classical BH3-containing proteins of organism Neovison vison

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           -----------------------------atggagccgcctcagtgtgtg
A0A8C7BAK5_BCL2L11      --------------------------------------------atggca
A0A8C7BAK5_BCL2L11      --------------------------------------------atggca
A0A8C7BAK5_BCL2L11      --------------------------------------------atggca
A0A8C7BAK5_BCL2L11      --------------------------------------------atggca
A0A8C7BEU9_PMAIP1-      ------------------------atgcc---------------tgggaa
A0A8C7AZM9_BBC3-01      nnnnnnnnnnnnnnnnnnnnnnnngtcctcagccctcactctcgccggcg
A0A8C7BYN9_BAD-01       ---------------atgttccagatcccagagtttgagcccagtgagca
                                                                       *  

U6CSY8_BMF-01           gaggagctg-------------gaggatgatgtgttccagccagaggatg
A0A8C7BAK5_BCL2L11      aagcaac-------cttcagatgtaagttctgagtgtgaccgagaag--g
A0A8C7BAK5_BCL2L11      aagcaac-------cttcagatgtaagttctgagtgtgaccgagaag--g
A0A8C7BAK5_BCL2L11      aagcaac-------cttcagatgtaagttctgagtgtgaccgagaag--g
A0A8C7BAK5_BCL2L11      aagcaac-------cttcagatgtaagttctgagtgtgaccgagaag--g
A0A8C7BEU9_PMAIP1-      gaa------------ggcgcgtaagagcgc-gcagccgagcccagcg--c
A0A8C7AZM9_BBC3-01      gag-----------ccgcacctggaatcgccggtgcccagtgccccg--g
A0A8C7BYN9_BAD-01       ggaagactccagccctgcagataggggc-ctgggccccagccccaca--g
                                                       *      *           

U6CSY8_BMF-01           gggagccggggacccagcc--tgggagcttgctctctgctgacctgtttg
A0A8C7BAK5_BCL2L11      tggacaattgcagcctgtt--gagaggcctcctcagctcaggcctggggc
A0A8C7BAK5_BCL2L11      tggacaattgcagcctgtt--gagaggcctcctcagctcaggcctggggc
A0A8C7BAK5_BCL2L11      tggacaattgcagcctgtt--gagaggcctcctcagctcaggcctggggc
A0A8C7BAK5_BCL2L11      tggacaattgcagcctgtt--gagaggcctcctcagctcaggcctggggc
A0A8C7BEU9_PMAIP1-      ggg-------c--cccagc---------------------------agac
A0A8C7AZM9_BBC3-01      ggg-------c--cctggc--gggcggccccacccaggcagccccgggag
A0A8C7BYN9_BAD-01       gggatcaaccc--ccaggccttggcaagcacctgcagacggccccaggcc
                         **          **                                   

U6CSY8_BMF-01           cccagagccagctggactgcccgcttagccgtctg---------------
A0A8C7BAK5_BCL2L11      cccta-------cctctctacagacagagcagcaa---------------
A0A8C7BAK5_BCL2L11      cccta-------cctctctacagacagagcagcaaggtaatcctgaaggc
A0A8C7BAK5_BCL2L11      cccta-------cctctctacagacagagcagcaaggtaatcctgaaggc
A0A8C7BAK5_BCL2L11      cccta-------cctctctacagacagagcagca----------------
A0A8C7BEU9_PMAIP1-      cccgaaatggag------------tgtgccattca---------------
A0A8C7AZM9_BBC3-01      tccggggggagg------------aggagcagtgg---------------
A0A8C7BYN9_BAD-01       tcctaggggaagctggtcaccagcaggggcagccg---------------
                         **                          *                    

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      gaaggggaccgctgcccccaaggcagccctcagggcccactggccccacc
A0A8C7BAK5_BCL2L11      gaaggggaccgctgcccccaaggcagccctcagggcccactggccccacc
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      --------------------------------------------------
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           --------------------------------------------------
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      tgccagccccggcccttttgctaccagatccccgcttttcatctttgtga
A0A8C7BAK5_BCL2L11      tgccagccccggcccttttgctaccagatccccgcttttcatctttgtga
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      --------------------------------------------------
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           -----------------------------------catctcttccctctc
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C7BAK5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      --------------------------------------------------
A0A8C7BYN9_BAD-01       --------------------------------------------------
                                                                          

U6CSY8_BMF-01           acccactgctgtggccctgggcttcgacccaccagccaggagga--caag
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      acagacaggag-----cccgg----cacccatgagttgtgacaaatcaac
A0A8C7BAK5_BCL2L11      acagacaggag-----cccgg----cacccatgagttgtgacaaatcaac
A0A8C7BAK5_BCL2L11      --agacaggag-----cccgg----cacccatgagttgtgacaaatcaac
A0A8C7BEU9_PMAIP1-      act--caggaa----------------------atttggagacaaactga
A0A8C7AZM9_BBC3-01      gcc--cgggag-----atcgg----ggccc---agctgcgga------gg
A0A8C7BYN9_BAD-01       gccagcagcagccaccatgga----ggcgctggggctgtggagacacgga
                                                                          

U6CSY8_BMF-01           gccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgcc
A0A8C7BAK5_BCL2L11      --------------------------------------------------
A0A8C7BAK5_BCL2L11      acaaacc-----------ccaagtcctccttgccaggccttcaaccatta
A0A8C7BAK5_BCL2L11      acaaacc-----------ccaagtcctccttgccaggccttcaaccatta
A0A8C7BAK5_BCL2L11      acaaacc-----------ccaagtcctccttgccaggccttcaaccatta
A0A8C7BEU9_PMAIP1-      at------------------------------------------------
A0A8C7AZM9_BBC3-01      atggctg-----------acgacctcaacgcgctg-----------tacg
A0A8C7BYN9_BAD-01       gtcgcca-----------cagctcgtaccccgcggggaccgaggaagatg
                                                                          

U6CSY8_BMF-01           ttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggct
A0A8C7BAK5_BCL2L11      -------------g-----------------cttccaggaggcagtctca
A0A8C7BAK5_BCL2L11      tctcagtgcaatgg-----------------cttccaggaggcagtctca
A0A8C7BAK5_BCL2L11      tctcagtgcaatgg-----------------cttccaggaggcagtctca
A0A8C7BAK5_BCL2L11      tctcagtgcaatgg-----------------cttccaggaggcagtctca
A0A8C7BEU9_PMAIP1-      ---------------------------------ttccggcagaaa-----
A0A8C7AZM9_BBC3-01      agcggcggagacaagaggag----------------cagcagcga-----
A0A8C7BYN9_BAD-01       aggggatggaggaagaagagcttagc----cctttccgggggcgctcgcg
                                                              *           

U6CSY8_BMF-01           accggctccctctccctgccagcttccctgcaggcttgcccctcggggac
A0A8C7BAK5_BCL2L11      ggctgtacct---------------------------------------g
A0A8C7BAK5_BCL2L11      ggctgtacct---------------------------------------g
A0A8C7BAK5_BCL2L11      ggctgtacct---------------------------------------g
A0A8C7BAK5_BCL2L11      ggctgtacct---------------------------------------g
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      --caccgccc---------------------------------------c
A0A8C7BYN9_BAD-01       gtcagcgccc---------------------------------------c
                                                                          

U6CSY8_BMF-01           cagccccctgaagggcagtggcagcatcgagcagaggtacagattgcccg
A0A8C7BAK5_BCL2L11      cagatatgcgcccggagatg-------------------tggattgcgca
A0A8C7BAK5_BCL2L11      cagatatgcgcccggagatg-------------------tggattgcgca
A0A8C7BAK5_BCL2L11      cagatatgcgcccggagatg-------------------tggattgcgca
A0A8C7BAK5_BCL2L11      cagatatgcgcccggagatg-------------------tggattgcgca
A0A8C7BEU9_PMAIP1-      ----cttctgaa---------------------------tctgat-----
A0A8C7AZM9_BBC3-01      tc--cccctggagggtcctg-------------------tacaat-----
A0A8C7BYN9_BAD-01       ccaacctctgtgcggcactg-------------------cgttatggccg
                                 *                                  *     

U6CSY8_BMF-01           aaagcttcagtgcattgcagaccagttccatcgacttcacatgcagcaac
A0A8C7BAK5_BCL2L11      ggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggc
A0A8C7BAK5_BCL2L11      ggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggg
A0A8C7BAK5_BCL2L11      ggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggt
A0A8C7BAK5_BCL2L11      ggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggt
A0A8C7BEU9_PMAIP1-      --------------------------------------atccaaactctt
A0A8C7AZM9_BBC3-01      ----------------------------------c-tcatcatgggactc
A0A8C7BYN9_BAD-01       cgagctccggaggatgagcgacgagttccagggct-ccttcaaggggctt
                                                                          

U6CSY8_BMF-01           accagcaaaaccaaaatcgggt----------gtggtggcagatccttct
A0A8C7BAK5_BCL2L11      t-------------------------------------------------
A0A8C7BAK5_BCL2L11      tctttt------------tgaataattacccagcagcagaagcccacccc
A0A8C7BAK5_BCL2L11      t-------------------------------------------------
A0A8C7BAK5_BCL2L11      t-------------------------------------------------
A0A8C7BEU9_PMAIP1-      tcggtc---------------------------------gggaacctga-
A0A8C7AZM9_BBC3-01      ctgccc-------------------ttacccaggggccgtggagcccca-
A0A8C7BYN9_BAD-01       cctctcccgaagagcgccggcacagccacgcagatgcggcagagccccag
                                                                          

U6CSY8_BMF-01           cttcctacacaaccttgctttgaacgcagatgggaacaggaatggggcgg
A0A8C7BAK5_BCL2L11      -------------------------------------------ggcaaga
A0A8C7BAK5_BCL2L11      caaatgattatcttacgactgttacgttacatcatccgcctggtgtggag
A0A8C7BAK5_BCL2L11      ------------------------------------------------ag
A0A8C7BAK5_BCL2L11      ------------------------------------------------ag
A0A8C7BEU9_PMAIP1-      --------------------------------------------------
A0A8C7AZM9_BBC3-01      ------------------------------------------gagatgga
A0A8C7BYN9_BAD-01       ttggacgcgcgtcatccagtcctggtgggatcggaacttggggagaggag
                                                                          

U6CSY8_BMF-01           g----------tcccaggtga
A0A8C7BAK5_BCL2L11      attccagcatcctgcctctgc
A0A8C7BAK5_BCL2L11      attgcagtga-----------
A0A8C7BAK5_BCL2L11      a--gcaatag-----------
A0A8C7BAK5_BCL2L11      a--gcaatag-----------
A0A8C7BEU9_PMAIP1-      ---------------------
A0A8C7AZM9_BBC3-01      g-----------cccaattag
A0A8C7BYN9_BAD-01       gctccgccccctcccaatga-
                                             

© 1998-2022Legal notice