Dataset for CDS classical BH3-containing proteins of organism Neovison vison

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C7AZM9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Neovison vison GN=BBC3 (length=582 residues).
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtcctcagccctcactctcgccggcggagccgcacctggaatcgcc
ggtgcccagtgccccgggggccctggcgggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggaggatggctgacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccgtggagc
cccagagatggagcccaattag
>gnl|bcl2dbcds|A0A8C7BAK5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccactggccccacctgccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatat
tacccaaggagggtctttttgaataattacccagcagcagaagcccacccccaaatgattatcttacgactgttacgtta
catcatccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A8C7BAK5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccactggccccacctgccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A8C7BAK5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctcaggctgta
cctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatattacccaag
gaggttagagcaatag
>gnl|bcl2dbcds|A0A8C7BAK5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccaggaggcagtctcaggctgtacctgcagata
tgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggctggca
agaattccagcatcctgcctctgc
>gnl|bcl2dbcds|A0A8C7BEU9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Neovison vison GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgtaagagcgcgcagccgagcccagcgcgggccccagcagaccccgaaatggagtgtgccat
tcaactcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactctttcggtcgggaa
cctga
>gnl|bcl2dbcds|A0A8C7BYN9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neovison vison GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggatcaacccccaggccttggcaagcacctgcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggctgtggagacacggagtcgccacagctcgtaccccgcggggacc
gaggaagatgaggggatggaggaagaagagcttagccctttccgggggcgctcgcggtcagcgccccccaacctctgtgc
ggcactgcgttatggccgcgagctccggaggatgagcgacgagttccagggctccttcaaggggcttcctctcccgaaga
gcgccggcacagccacgcagatgcggcagagccccagttggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|U6CSY8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Neovison vison GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgcccgcttagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaggacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagcttccctgcaggcttgcccctcggggaccagccccctgaagggcagtggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcgacttcacatgcagcaacaccagcaaaaccaaaatcgggtgtgg
tggcagatccttctcttcctacacaaccttgctttgaacgcagatgggaacaggaatggggcgggtcccaggtga
© 1998-2022Legal notice