Dataset for CDS BAD of organism Neogobius melanostomus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6U7V6_BAD-03      atgccagccgtacagccacctttaccgtactctcataatgtaaagctcag
A0A8C6U7V6_BAD-01      atg--------gctgcgagcttcaccat-ctctgacagtg----------
A0A8C6U7V6_BAD-02      -------------------------------------ttg----------
                                                             **          

A0A8C6U7V6_BAD-03      cacgtgtgtccaatatgacccatctgac----------------------
A0A8C6U7V6_BAD-01      -----------aatcggacccgtctgaagacttggacgaggaacagggca
A0A8C6U7V6_BAD-02      -----------aat------------------------------------
                                  ***                                    

A0A8C6U7V6_BAD-03      --------------------------------------------------
A0A8C6U7V6_BAD-01      acagagcaaaggcccagcgcaaactgcagctcaaactgcccgagctccga
A0A8C6U7V6_BAD-02      --------------------------------------------------
                                                                         

A0A8C6U7V6_BAD-03      ------agcgataacaaaac-------------aaatacttgttccttgg
A0A8C6U7V6_BAD-01      ggagcaggcatcggcagaatccggctgagctcagagtcccaagtgtgtgg
A0A8C6U7V6_BAD-02      ------agcatcggcagaatccggctgagctcagagtcccaagtgtgtgg
                              **     ** **               * * *    *   ***

A0A8C6U7V6_BAD-03      ggctacaggccagggctgaagaggagctgggcacccccactgatgggttc
A0A8C6U7V6_BAD-01      tg----aggccagggctgaagaggagctgggcacccccactgatgggttc
A0A8C6U7V6_BAD-02      tg----aggccagggctgaagaggagctgggcacccccactgatgggttc
                        *    ********************************************

A0A8C6U7V6_BAD-03      cctttccggggacgctccaagtcagcccccccagctctgtgggccgccaa
A0A8C6U7V6_BAD-01      cctttccggggacgctccaagtcagcccccccagctctgtgggccgccaa
A0A8C6U7V6_BAD-02      cctttccggggacgctccaagtcagcccccccagctctgtgggccgccaa
                       **************************************************

A0A8C6U7V6_BAD-03      gaagtacgggcggcagctgcggcgcatgagcgacgagttcgacagcatgc
A0A8C6U7V6_BAD-01      gaagtacgggcggcagctgcggcgcatgagcgacgagttcgacagcatgc
A0A8C6U7V6_BAD-02      gaagtacgggcggcagctgcggcgcatgagcgacgagttcgacagcatgc
                       **************************************************

A0A8C6U7V6_BAD-03      tggacaaagg------------------gaacagcaggcccatccagcac
A0A8C6U7V6_BAD-01      tggacaaaggggaaatgaagaagatgaagaacagcaggcccatccagcac
A0A8C6U7V6_BAD-02      tggacaaagg------------------gaacagcaggcccatccagcac
                       **********                  **********************

A0A8C6U7V6_BAD-03      tccaagacctggtggagctacttgttcagccaccaggaaacagagggaga
A0A8C6U7V6_BAD-01      tccaagacctggtggagctacttgttcagccaccaggaaacagagggaga
A0A8C6U7V6_BAD-02      tccaagacctggtggagctacttgttcagccaccaggaaacagagggaga
                       **************************************************

A0A8C6U7V6_BAD-03      gaaccaccacgactcacagcgcaccgagtag
A0A8C6U7V6_BAD-01      gaaccaccacgactcacagcgcaccgagtag
A0A8C6U7V6_BAD-02      gaaccaccacgactcacagcgcaccgagtag
                       *******************************

© 1998-2022Legal notice