Dataset for CDS BAD of organism Neogobius melanostomus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C6U7V6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neogobius melanostomus GN=BAD (length=447 residues).
atggctgcgagcttcaccatctctgacagtgaatcggacccgtctgaagacttggacgaggaacagggcaacagagcaaa
ggcccagcgcaaactgcagctcaaactgcccgagctccgaggagcaggcatcggcagaatccggctgagctcagagtccc
aagtgtgtggtgaggccagggctgaagaggagctgggcacccccactgatgggttccctttccggggacgctccaagtca
gcccccccagctctgtgggccgccaagaagtacgggcggcagctgcggcgcatgagcgacgagttcgacagcatgctgga
caaaggggaaatgaagaagatgaagaacagcaggcccatccagcactccaagacctggtggagctacttgttcagccacc
aggaaacagagggagagaaccaccacgactcacagcgcaccgagtag
>gnl|bcl2dbcds|A0A8C6U7V6_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neogobius melanostomus GN=BAD (length=309 residues).
ttgaatagcatcggcagaatccggctgagctcagagtcccaagtgtgtggtgaggccagggctgaagaggagctgggcac
ccccactgatgggttccctttccggggacgctccaagtcagcccccccagctctgtgggccgccaagaagtacgggcggc
agctgcggcgcatgagcgacgagttcgacagcatgctggacaaagggaacagcaggcccatccagcactccaagacctgg
tggagctacttgttcagccaccaggaaacagagggagagaaccaccacgactcacagcgcaccgagtag
>gnl|bcl2dbcds|A0A8C6U7V6_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neogobius melanostomus GN=BAD (length=372 residues).
atgccagccgtacagccacctttaccgtactctcataatgtaaagctcagcacgtgtgtccaatatgacccatctgacag
cgataacaaaacaaatacttgttccttggggctacaggccagggctgaagaggagctgggcacccccactgatgggttcc
ctttccggggacgctccaagtcagcccccccagctctgtgggccgccaagaagtacgggcggcagctgcggcgcatgagc
gacgagttcgacagcatgctggacaaagggaacagcaggcccatccagcactccaagacctggtggagctacttgttcag
ccaccaggaaacagagggagagaaccaccacgactcacagcgcaccgagtag
© 1998-2022Legal notice