Dataset for CDS classical BH3-containing proteins of organism Naja naja

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6VGF4_BCL2L11      -----------------atggcaaaacaatcttctgatttaa--------
A0A8C6Y3T4_PMAIP1-      ------------------------------cttccgg-------ggaa--
A0A8C6VCH5_BMF-01       atgcaagggcaagaaataggtgaaatggatcctcctgtttacctggaaga
A0A8C6VCH5_BMF-02       ------------------------atggatcctcctgtttacctggaaga
A0A8C6VCH5_BMF-03       ------------------------atggatcctcctgtttacctggaaga
                                                      * **                

A0A8C6VGF4_BCL2L11      --attctg------agtgtgagagagaaggtggacaattgcagcctgctg
A0A8C6Y3T4_PMAIP1-      --attttt------------------------------------------
A0A8C6VCH5_BMF-01       cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
A0A8C6VCH5_BMF-02       cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
A0A8C6VCH5_BMF-03       cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
                          *** *                                           

A0A8C6VGF4_BCL2L11      aaag-----------gccagctcagcctcatcaccttcggcctggggccc
A0A8C6Y3T4_PMAIP1-      ----------------------cagaa-----------------------
A0A8C6VCH5_BMF-01       actgtgaactcgtcagtcagtccagcaagatggcctt-------------
A0A8C6VCH5_BMF-02       actgtgaactcgtcagtcagtccagcaagatggcctt-------------
A0A8C6VCH5_BMF-03       actgtgaactcgtcagtcagtccagcaagatggcctt-------------
                                              ***                         

A0A8C6VGF4_BCL2L11      ctacctccttacaaactgaatatcaaggtaatcatttgggtgaacgggac
A0A8C6Y3T4_PMAIP1-      --------------------------ggtact------------------
A0A8C6VCH5_BMF-01       ----------------------tcgtggcatt------------------
A0A8C6VCH5_BMF-02       ----------------------tcgtggcatt------------------
A0A8C6VCH5_BMF-03       ----------------------tcgtggcatt------------------
                                                  ** * *                  

A0A8C6VGF4_BCL2L11      agttcatcacccggtagccctcagggaccactggcaccaccctccagtcc
A0A8C6Y3T4_PMAIP1-      --ttcagcagcagca-----t-----accact------------------
A0A8C6VCH5_BMF-01       --ttcacccaaagcaaatctt-----acaactgcctcc------------
A0A8C6VCH5_BMF-02       --ttcacccaaagcaaatctt-----acaactgcctcc------------
A0A8C6VCH5_BMF-03       --ttcacccaaagcaaatctt-----acaactgcctcc------------
                          **** *    *       *     ** ***                  

A0A8C6VGF4_BCL2L11      cagtccatttgcaaccagatccccgttgttcatgtttgtaagaagatccc
A0A8C6Y3T4_PMAIP1-      ----------------aggt----gctct---------------------
A0A8C6VCH5_BMF-01       -----------tgggcaggttccagctcttcccacttacgca--------
A0A8C6VCH5_BMF-02       -----------tgggcaggttccagctcttcccacttacgca--------
A0A8C6VCH5_BMF-03       -----------tgggcaggttccagctcttcccacttacgca--------
                                        ** *    * * *                     

A0A8C6VGF4_BCL2L11      cactgctgtccagatcctccagtgggtatttctcttttgacatcgacagg
A0A8C6Y3T4_PMAIP1-      ---------------------------------------gccctgatagc
A0A8C6VCH5_BMF-01       -------------------------------ctgttgtggcccaggcagc
A0A8C6VCH5_BMF-02       -------------------------------ctgttgtggcccaggcagc
A0A8C6VCH5_BMF-03       -------------------------------ctgttgtggcccaggcagc
                                                                *   *  ** 

A0A8C6VGF4_BCL2L11      agtcctgcacctatgaattgtgacaaagcaacacagactccaagtcc---
A0A8C6Y3T4_PMAIP1-      a-------------------------------------------------
A0A8C6VCH5_BMF-01       aggcatg---ccaaacaacaggacaaggcaacacagaccctcaatgcatc
A0A8C6VCH5_BMF-02       aggcatg---ccaaacaacaggacaaggcaacacagaccctcaatgcatc
A0A8C6VCH5_BMF-03       aggcatg---ccaaacaacaggacaaggcaacacagaccctcaatgcatc
                        *                                                 

A0A8C6VGF4_BCL2L11      ---tccgtgtcaagctatca------------------------------
A0A8C6Y3T4_PMAIP1-      ---ttgcagct---------------------------------------
A0A8C6VCH5_BMF-01       ctcttccagccaggatatcatgttaccttgcggagtcactgaagagcctc
A0A8C6VCH5_BMF-02       ctcttccagccaggatatcatgttaccttgcggagtcactgaagagcctc
A0A8C6VCH5_BMF-03       ctcttccagccaggatatcatgttaccttgcggagtcactgaagagcctc
                           *    *                                         

A0A8C6VGF4_BCL2L11      ------atcattatctaagtgc------------------------aatg
A0A8C6Y3T4_PMAIP1-      ------------------acgcag----------------------aatt
A0A8C6VCH5_BMF-01       agagactcttttatggaaacgctggataccgtttacatgtccaaccaatc
A0A8C6VCH5_BMF-02       agagactcttttatggaaacgctggataccgtttacatgtccaaccaatc
A0A8C6VCH5_BMF-03       agagactcttttatggaaacgctggataccgtttacatgtccaaccaatc
                                            **                        *** 

A0A8C6VGF4_BCL2L11      ggt----aagcaagagcatgcttccagatggcagtcacggccaatacctg
A0A8C6Y3T4_PMAIP1-      ggggacaaatgga------atctccagca--------------------a
A0A8C6VCH5_BMF-01       ggtttcacattgaatccacatctccaggaggaacctcaggaaagtctgca
A0A8C6VCH5_BMF-02       ggtttcacattgaatccacatctccaggaggaacctcaggaaagtctgca
A0A8C6VCH5_BMF-03       ggtttcacattgaatccacatctccaggaggaacctcaggaaagtctgca
                        **      *   *         *****                       

A0A8C6VGF4_BCL2L11      aggatatgcagccagaaatatggattgcacaggaattacggcgtattgga
A0A8C6Y3T4_PMAIP1-      agaat-t-----ctgaacctc-----------------------------
A0A8C6VCH5_BMF-01       ggaat-tgcgtaccgaagttcagattgcacggaagttacagtgcattgca
A0A8C6VCH5_BMF-02       ggaat-tgcgtaccgaagttcagattgcacggaagttacagtgcattgca
A0A8C6VCH5_BMF-03       ggaat-tgcgtaccgaagttcagattgcacggaagttacagtgcattgca
                         * ** *     * ***                                 

A0A8C6VGF4_BCL2L11      gatgaattt--aatgcttcctactgtccaag-------------------
A0A8C6Y3T4_PMAIP1-      ------ttctccaagc-tctt-ctgcccagg-------------------
A0A8C6VCH5_BMF-01       gatcagttccacaggcttcat-ctacagaggcacctgctctggaccattg
A0A8C6VCH5_BMF-02       gatcagttccacaggcttcat-ctacagaggcacctgctctggaccattg
A0A8C6VCH5_BMF-03       gatcagttccacaggcttcat-ctacagagg-------------------
                              **    * ** ** * **    * *                   

A0A8C6VGF4_BCL2L11      -------------------aaggggtttattggattaccagggagtaaat
A0A8C6Y3T4_PMAIP1-      --------------------------------------------------
A0A8C6VCH5_BMF-01       aggggtctgcagcagccattcataacttggcggtctctagatatgtccac
A0A8C6VCH5_BMF-02       aggggtctgcagcagccattcataacttggcggtctctagatatgtccac
A0A8C6VCH5_BMF-03       -----------------------------------------------cac
                                                                          

A0A8C6VGF4_BCL2L11      caccagatcataattttgcgccttttgcattacatcgtc---------cg
A0A8C6Y3T4_PMAIP1-      ------------------------------------------------aa
A0A8C6VCH5_BMF-01       cagcagaacagaaatcaggtctggtggcagatccttctcttcctccataa
A0A8C6VCH5_BMF-02       cagcagaacagaaatcaggtctggtggcagatccttctcttcctccataa
A0A8C6VCH5_BMF-03       cagcagaacagaaatcaggtctggtggcagatccttctcttcctccataa
                                                                          

A0A8C6VGF4_BCL2L11      cttcatatggagaatgca---------------------------gtga
A0A8C6Y3T4_PMAIP1-      cttga--------------------------------------------
A0A8C6VCH5_BMF-01       cttggccttgaacgtggaagccaacagacaacgtgtgggtcagaggtga
A0A8C6VCH5_BMF-02       cttggccttgaacgtggaagccaacagacaacgtgtgggtcagaggtga
A0A8C6VCH5_BMF-03       cttggccttgaacgtggaagccaacagacaacgtgtgggtcagaggtga
                        ***                                              

© 1998-2022Legal notice