Dataset for CDS BMF of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q91ZE9_BMF-02      atgtc-------------------------------------------------------
Q91ZE9_BMF-01      atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctcccg
Q91ZE9_BMF-06      ------------------------------------------------------------

Q91ZE9_BMF-02      ------------------------------------------------------------
Q91ZE9_BMF-01      cgccagctcgcgcctgcagcagtcgctgccgcagcccgcgccaccgcctcccaccgcagc
Q91ZE9_BMF-06      ------------------------------------------------------------

Q91ZE9_BMF-02      ------------------------------------------------------------
Q91ZE9_BMF-01      ccgctggagtttgcccccttcttcccaatcgagtgtgggcaccaagccccccgagtgttc
Q91ZE9_BMF-06      ------------------------------------------------------------

Q91ZE9_BMF-02      ------------------------------------------------------------
Q91ZE9_BMF-01      ttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
Q91ZE9_BMF-06      ------------------------------------------------------------

Q91ZE9_BMF-02      --------cccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
Q91ZE9_BMF-01      tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
Q91ZE9_BMF-06      ------------------atggagccacctcagtgtgtggaggagctagaagatgatgtg

Q91ZE9_BMF-02      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg
Q91ZE9_BMF-01      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg
Q91ZE9_BMF-06      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg

Q91ZE9_BMF-02      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat
Q91ZE9_BMF-01      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat
Q91ZE9_BMF-06      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat

Q91ZE9_BMF-02      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
Q91ZE9_BMF-01      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
Q91ZE9_BMF-06      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt

Q91ZE9_BMF-02      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga
Q91ZE9_BMF-01      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga
Q91ZE9_BMF-06      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga

Q91ZE9_BMF-02      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
Q91ZE9_BMF-01      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
Q91ZE9_BMF-06      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca

Q91ZE9_BMF-02      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc
Q91ZE9_BMF-01      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc
Q91ZE9_BMF-06      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc

Q91ZE9_BMF-02      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
Q91ZE9_BMF-01      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
Q91ZE9_BMF-06      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag

Q91ZE9_BMF-02      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac
Q91ZE9_BMF-01      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac
Q91ZE9_BMF-06      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac

Q91ZE9_BMF-02      agacaagaaaacagggaaggggtggggccctggtga
Q91ZE9_BMF-01      agacaagaaaacagggaaggggtggggccctggtga
Q91ZE9_BMF-06      agacaagaaaacagggaaggggtggggccctggtga

© 1998-2021Legal notice