Dataset for CDS BMF of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A2AV74_BMF-02      atgtc-------------------------------------------------------
A2AV74_BMF-01      atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctcccg
A2AV74_BMF-06      ------------------------------------------------------------

A2AV74_BMF-02      ------------------------------------------------------------
A2AV74_BMF-01      cgccagctcgcgcctgcagcagtcgctgccgcagcccgcgccaccgcctcccaccgcagc
A2AV74_BMF-06      ------------------------------------------------------------

A2AV74_BMF-02      ------------------------------------------------------------
A2AV74_BMF-01      ccgctggagtttgcccccttcttcccaatcgagtgtgggcaccaagccccccgagtgttc
A2AV74_BMF-06      ------------------------------------------------------------

A2AV74_BMF-02      ------------------------------------------------------------
A2AV74_BMF-01      ttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
A2AV74_BMF-06      ------------------------------------------------------------

A2AV74_BMF-02      --------cccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
A2AV74_BMF-01      tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
A2AV74_BMF-06      ------------------atggagccacctcagtgtgtggaggagctagaagatgatgtg

A2AV74_BMF-02      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg
A2AV74_BMF-01      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg
A2AV74_BMF-06      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctctgctgacctg

A2AV74_BMF-02      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat
A2AV74_BMF-01      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat
A2AV74_BMF-06      tttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcacccat

A2AV74_BMF-02      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
A2AV74_BMF-01      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
A2AV74_BMF-06      tgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt

A2AV74_BMF-02      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga
A2AV74_BMF-01      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga
A2AV74_BMF-06      ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagaga

A2AV74_BMF-02      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
A2AV74_BMF-01      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
A2AV74_BMF-06      ctcttttacggcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca

A2AV74_BMF-02      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc
A2AV74_BMF-01      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc
A2AV74_BMF-06      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcagatc

A2AV74_BMF-02      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
A2AV74_BMF-01      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
A2AV74_BMF-06      gccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag

A2AV74_BMF-02      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac
A2AV74_BMF-01      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac
A2AV74_BMF-06      cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaac

A2AV74_BMF-02      agacaagaaaacagggaaggggtggggccctggtga
A2AV74_BMF-01      agacaagaaaacagggaaggggtggggccctggtga
A2AV74_BMF-06      agacaagaaaacagggaaggggtggggccctggtga

© 1998-2020Legal notice