Dataset for CDS BMF of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|Q91ZE9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=816 residues).
atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctcccgcgccagctcgcgcctgcagc
agtcgctgccgcagcccgcgccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtgggc
accaagccccccgagtgttcttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatgggga
gccagggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactcc
agctcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctgg
ctacaggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagc
accgagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
ggtggggccctggtga
>gnl|bcl2dbcds|Q91ZE9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=573 residues).
atgtccccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagcc
agggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactccagc
tcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtcca
gcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggcta
caggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcacc
gagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcag
aaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggt
ggggccctggtga
>gnl|bcl2dbcds|Q91ZE9_BMF-06 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagccagggacacagcctgg
gggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcaccc
attgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtccagcttccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcaga
tcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcagaaccgagaccgtgcg
tggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggtggggccctggtga
© 1998-2022Legal notice