Dataset for CDS classical BH3-containing proteins of organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1MV54_BCL2L11-01       gggatgaaaagtcccgaagtttgctctgagtgcact---ttagccaacac
A0A803YIP1_PMAIP1-      -------------------ttatctggaaaagacct--------------
A0A803YBD7_BMF-01       ---atggatcgcccc--agctacctggaagaggactattctagcctggat
A0A803YBD7_BMF-02       ---atggatcgcccc--agctacctggaagaggactattctagcctggat
                                            *  **   *  *  **              

G1MV54_BCL2L11-01       tggtacaaggctgcagcatgcacatcgcacggccagtcttgattttgttc
A0A803YIP1_PMAIP1-      ------------------------------------cgttagaatt----
A0A803YBD7_BMF-01       gggctggacgatg----acgtgtttcactctgatgactttggacttgcag
A0A803YBD7_BMF-02       gggctggacgatg----acgtgtttcactctgatgactttggacttgca-
                                                              **    **    

G1MV54_BCL2L11-01       ct------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A803YBD7_BMF-01       gtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcc
A0A803YBD7_BMF-02       --------------------------------------------------
                                                                          

G1MV54_BCL2L11-01       --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A803YBD7_BMF-01       tacagctgccttctggggaggtttcaactatttcccctcacacactgctg
A0A803YBD7_BMF-02       --------------------------------------------------
                                                                          

G1MV54_BCL2L11-01       --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A803YBD7_BMF-01       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A803YBD7_BMF-02       --------------------------------------------------
                                                                          

G1MV54_BCL2L11-01       ------------------------------------------gtttccaa
A0A803YIP1_PMAIP1-      ----------------------------------------aaatccccat
A0A803YBD7_BMF-01       tcagcccgtcctcttccaagccccggagactcttctatgggaatgctggt
A0A803YBD7_BMF-02       --------------------------------------gggaatgctggt
                                                                   *      

G1MV54_BCL2L11-01       cgctctgtttttgctc-----------tgtgcag-----------cttcc
A0A803YIP1_PMAIP1-      cgccctgcgcgtgttc-------------tgcag----------------
A0A803YBD7_BMF-01       taccgcttacatgtccccccagttggctttgcattggatccaaatctcca
A0A803YBD7_BMF-02       taccgcttacatgtccccccagttggctttgcattggatccaaatctcca
                          *        **  *             ****                 

G1MV54_BCL2L11-01       aggtggcgatctcactcacttgcagaagaaatacaaccagaaatatggat
A0A803YIP1_PMAIP1-      --------------------agcgg--gacgcggtggctga-gtgc----
A0A803YBD7_BMF-01       agaagagcctcaggaaggtcagcgg--gaggcgcgtactgaggtgcagat
A0A803YBD7_BMF-02       agaagagcctcaggaaggtcagcgg--gaggcgcgtactgaggtgcagat
                                             ** *  **        * **  *      

G1MV54_BCL2L11-01       tgcacaggagctgcggcgcatcggggatgaattcaatgcctcctattctc
A0A803YIP1_PMAIP1-      -gcactggagctgcgcaagatcggcgacaaggcggac-------------
A0A803YBD7_BMF-01       tgcacggaagttgcagtgcattgcagaccagttccac-------------
A0A803YBD7_BMF-02       tgcacggaagttgcagtgcattgcagaccagttccac-------------
                         **** * ** ***     ** *  **  *     *              

G1MV54_BCL2L11-01       tccccagattgggtgcctgtcctgatgctgccccgcatccactcttgcct
A0A803YIP1_PMAIP1-      ---------------------------c---------taca---------
A0A803YBD7_BMF-01       ---------------------------cggctccacataca---------
A0A803YBD7_BMF-02       ---------------------------cggctccacataca---------
                                                   *         * **         

G1MV54_BCL2L11-01       ctgctctctcaccag--ctcattctttttgagttcatatgtttttctcct
A0A803YIP1_PMAIP1-      --gcagaa-----agtcctgaacctcatcgcg-----aaacttttct---
A0A803YBD7_BMF-01       --gcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt
A0A803YBD7_BMF-02       --gcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt
                          **         **  *  *        * *     *   ******   

G1MV54_BCL2L11-01       gctctggagtcagcagcttcccttgtggatttgctcgttttccctccctg
A0A803YIP1_PMAIP1-      ---------------gcccca---------------agaaacc------g
A0A803YBD7_BMF-01       tctacacaacttg--gccttaaatgtggaggcgaacaggaacc------g
A0A803YBD7_BMF-02       tctacacaacttg--gccttaaatgtggaggcgaacaggaacc------g
                                       **                        **      *

G1MV54_BCL2L11-01       ctgctcacgtgggtga
A0A803YIP1_PMAIP1-      cgcc-cgcggtgctga
A0A803YBD7_BMF-01       cactgggcagaggtga
A0A803YBD7_BMF-02       cactgggcagaggtga
                        *      *   * ***

© 1998-2022Legal notice